Taurine 6 (Advances in Experimental Medicine and Biology Vol 583)

TAURINE 6

ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY Editorial Board: NATHAN BACK, State University of New York at Buffalo IRUN R. COHEN, The Weizmann Institute of Science DAVID KRITCHEVSKY, Wistar Institute ABEL LAJTHA, N.S. Kline Institute for Psychiatric Research

RODOLFO PAOLETTI, University of Milan Recent Volumes in this Series Volume 575 DIPEPTIDYL AMINOPEPTIDASES: BASIC SCIENCE AND CLINICAL APPLICATIONS Edited by Uwe Lendeckel, Ute Bank, and Dirk Reinhold Volume 576 N-ACETYLASPARTATE: A UNIQUE NEURONAL MOLECULE IN THE CENTRAL NERVOUS SYSTEM Edited by John R. Moffett, Suzannah B. Tieman, Daniel R. Weinberger, Joseph T. Coyle and Aryan M.A. Namboodiri Volume 577 EARLY LIFE ORIGINS OF HEALTH AND DISEASE Edited by E. Marelyn Wintour and Julie A. Owens Volume 578 OXYGEN TRANSPORT TO TISSUE XXVII Edited by Giuseppe Cicco, Duane Bruley, Marco Ferrari, and David K. Harrison Volume 579 IMMUNE MECHANISMS IN INFLAMMATORY BOWEL DISEASE Edited by Richard S. Blumberg Volume 580 THE ARTERIAL CHEMORECEPTORS Edited by Yoshiaki Hayashida, Constancio Gonzalez, and Hisatake Condo Volume 581 THE NIDOVIRUSES: THE CONTROL OF SARS AND OTHER NIDOVIRUS DISEASES Edited by Stanley Perlman and Kathryn Holmes Volume 582 HOT TOPICS IN INFECTION AND IMMUNITY IN CHILDREN III Edited by Andrew J. Pollard and Adam Finn Volume 583 TAURINE 6 Edited by Simo S. Oja and Pirjo Saransaari A Continuation Order Plan is available for this series. A continuation order will bring delivery of each new volume immediately upon publication. Volumes are billed only upon actual shipment. For further information please contact the publisher.

TAURINE 6 Edited by

Simo S. Oja Tampere University Hospital Tampere, Finland

and

Pirjo Saransaari University of Tampere Tampere, Finland

Simo S. Oja The Center for Laboratory Medicine Tampere University Hospital PO Box 2000 FI-33521 Tampere, Finland [emailprotected]

Pirjo Saransaari Brain Research Center Medical School FI-33014 University of Tampere, Finland [emailprotected]

Proceedings of the 15th International Taurine Meeting, “Taurine Today,” held in Tampere, Finland, June 12–15, 2005 A CIP record for this book is available from the Library of Congress. ISSN: 0065 2598 ISBN-10: 0-387-32356-2 ISBN-13: 978-0387-32356-5

e-ISBN 0-387-33504-8

Printed on acid-free paper. ¤ 2006 Springer Science+Business Media, LLC All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks and similar terms, even if the are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed in the United States of America. 9 8 7 6 5 4 3 2 1 springer.com

(EB)

PREFACE The 15th Taurine Meeting, “Taurine Today,” was held June 12–15, 2005, in Tampere, Finland. Tampere is the third largest city (200,000 inhabitants) in Finland and the largest inland city in Scandinavia, located 109 miles north of Helsinki, capital of Finland. The meeting venue was the Scandic Hotel Rosendahl on the shores of the Lake Pyhäjärvi, located about two miles from the city center on a hillside of the highest sand ridge in the world. This narrow ridge was formed by the Ice Age between two large lakes, embracing the present-day city of Tampere. Approximately 80 individuals attended this meeting from twenty-one countries and four continents. The present meeting continued the prestigious series of taurine meetings, regularly gathering together most of the prominent investigators in the field. The scientific program consisted of thirty-three platform and forty-seven poster presentations. This volume is based on these presentations given at the meeting. The topics range from the presence and metabolism of taurine in microorganisms to the applicability of taurine derivatives in clinical medicine. Characterization of the significance of taurine in nutrition and of the putative functions in the organisms was also emphasized, among several other aspects of taurine. The Finnish Physiological Society and Tampere University Brain Research Center were the official organizations sponsoring the meeting. The Program Committee, Professors Junichi Azuma, Laura Della Corte, J. Barry Lombardini, Stephen W. Schaffer, Simo S. Oja, and Pirjo Saransaari, cooperated in composing the meeting program. The heaviest burden of all practical matters was on the shoulders of the Organizing Committee, including Prof. Simo S. Oja, Prof. Pirjo Saransaari, Assoc. Prof. Kirsi-Marja Marnela, Assoc. Prof. Vince Varga, Dr. Satoshi Abe, Dr. Sirpa Rainesalo, and Ms. Svetlana Molchanova, MSci. The organizers of the meeting are indebted to the Academy of Finland; Tampere University Research Fund; Taisho Pharmaceutical Company, Ltd., Japan; Red Bull GmBh, Austria; Korean Taurine Society; Dong-A Pharmaceutical Company, Korea; and the organizer of the previous taurine meeting, Prof. Stephen Schaffer, for their generous financial support. The organizers likewise thank Ms. Svetlana Molchanova, MSci; Mr. Pasi Puumala, BMed; and Mr. Róbert Dohovics, MSci, for their skilful technical help with computers, Power Point shows, and microphones during the meeting. The excellent professional competence of the staff of the TAVI Congress Bureau, in particular that of, the managing director, Ms. Anja Hakkarainen, and the kind cooperation of the personnel of the Scandic Hotel Rosendahl, were greatly appreciated. Ms. Sari Luokkala gave us expert advice and technical help in editing the manuscripts.

PREFACE

Finally, the organizers wish to thank all the participants of the meeting and the authors of the papers in this volume. Their invaluable contributions made everything worth our efforts. The presentations at the meeting and the articles in this volume shed bright light on the various aspects of the significance and role of taurine, although many questions still remain unanswered. This calls for the next taurine meeting to be organized in about two years’ time.

Simo S. Oja Pirjo Saransaari University of Tampere

PARTICIPANTS Satoshi Abe Taurine Project Team Taisho Pharmaceutical Co, Ltd Tokyo, Japan [emailprotected] Elmira Anderzhanova University of Athens Medical School Athens, Greece [emailprotected] Junichi Azuma Clinical Evaluation of Medicines and Therapeutics Graduate School of Pharmaceutical Sciences Osaka University Osaka, Japan [emailprotected] Laura Bianchi Dipartimento di Farmakologia Preclinica e Clinica Università degli Studi di Firenze Florence, Italy [emailprotected] David Brouchier-Hayes Department of Surgery Royal College of Surgeons Beaumont Hospital Dublin, Ireland [emailprotected]

John Browne Department of Surgery Royal College of Surgeons Beaumont Hospital Dublin, Ireland [emailprotected] Marie-Louise Bülow Institute of Molecular Biology University of Copenhagen, Copenhagen, Denmark [emailprotected] Kyung Ja Chang Department of Food and Nutrition Inha University Incheon, South Korea [emailprotected] Aisa Chepkova Institute of Neurophysiology Heinrich-Heine University Düsseldorf, Germany [emailprotected] Russel W. Chesney Department of Pediatrics University of Tennessee Health Sciences Center Le Bonheur Children’s Medical Center Memphis, TN, USA [emailprotected]

vii

viii

Alasdair Cook Department of Biological Sciences University of Constance Constance, Germany [emailprotected] Robért Dohovics Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] John Dominy Division of Nutritional Sciences Cornell University Ithaca, NY, USA [emailprotected] Abdeslem El Idrissi Department of Biology and Center for Development College of Staten Island/CUNY Staten Island, NY, USA [emailprotected] Mario Fontana Dipartimento di Scienze Biochimiche, Università di Roma “La Sapienza” Rome, Italy [emailprotected] Kjell Fugelli Department of Molecular Biosciences University of Oslo Oslo, Norway [emailprotected] Ludmila Gavrovskaya Research Institute of Experimental Medicine Russian Academyof Medical Sciences St. Petersburg, Russia [emailprotected]

PARTICIPANTS

Jingchun Guo Department of Integrative Medicine Shanghai Medical College Fudan University Shanghai, China [emailprotected] Ramesh Gupta SASRD Nagaland University Medziphema, India [emailprotected] Xiaobin Han Department of Pediatrics University of Tennessee Health Sciences Center Le Bonheur Children’s Medical Center Memphis, TN, USA [emailprotected] Svend H. Hansen Department of Clinical Biochemistry Rigshospitalet Copenhagen University Hospital Copenhagen, Denmark [emailprotected] Antonio Herranz Servicio de Neurobiología Hospital Ramón y Cajal Madrid, Spain [emailprotected] Wojciech Hilgier Department of Neurotoxicology Medical Research Centre Polish Academy of Sciences Warsaw, Poland [emailprotected] Tuomas Huttunen Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected]

PARTICIPANTS

Takashi Ito Clinical Evaluation of Medicines and Therapeutics Graduate School of Pharmaceutical Sciences Osaka University Osaka, Japan [emailprotected]_u.ac.jp Réka Janáky Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Young-Sook Kang College of Pharmacy Sookmyung Women’s University, Seoul, Korea [emailprotected] Tomie Kawada Pharmacy Division Niigata University Hospital Niigata, Japan [emailprotected] Chaekyun Kim Center for Advanced Medical Education by BK21 Project Inha University College of Medicine Incheon, 400-712, Korea [emailprotected] Ha Won Kim Department of Life Sciences University of Seoul Seoul, South Korea [emailprotected] Vija Kluša Department of Pharmacology Faculty of Medicine University of Latvia Riga, Latvia [emailprotected]

Ewa Kontny Department of Pathophysiology & Immunology Institute of Rheumatology Warsaw, Poland [emailprotected] Irina B. Krylova Research Institute of Experimental Medicine Russian Academy of Medical Sciences St. Petersburg, Russia [emailprotected] Nien Vinh Lam School of Food and Nutritional Sciences University of Shizuoka Shizuoka, Japan [emailprotected] Ian Henry Lambert Department of Biochemistry Institute for Molecular Biology and Physiology Copenhagen, Denmark [emailprotected] Cesar Lau-Cam Department of Pharmaceutical Sciences, College of Pharmacy and Allied Health Professions St. John’s University Jamaica, NY, USA [emailprotected] Robert Law Department of Preclinical Sciences University of Leicester Leicester, UK [emailprotected] Florence Ledeque Unite de Biochimie Universitè Catholique de Louvain Louvain-la-Neuve, Belgium [emailprotected]

PARTICIPANTS

Dong-Hee Lee Department of Life Sciences University of Seoul Seoul, South Korea [emailprotected]

Dietrich V. Michalk Department of Pediatrics University of Köln Cologne, Germany [emailprotected]

Natalia Levinskaya Department of Biology and Center for Development College of Staten Island/CUNY Staten Island, NY, USA [emailprotected]

Tadaomi Miyamoto Research Department Kokura Memorial Hospital Kitakyushu-City, Japan [emailprotected]

Lucimey Lima Laboratorio de Neuroquímica Centro de Biofísica y Bioquímica Instituto Venezolano de Investigaciones Científicas Caracas, Venezuela [emailprotected] J. Barry Lombardini Department of Pharmacology Texas Tech University Health Sciences Center Lubbock, TX, USA [emailprotected] Janusz Marcinkiewicz Department of Immunology Jagiellonian University Medical College Cracow, Poland [emailprotected] Kirsi-Marja Marnela University of Tampere Tampere, Finland [emailprotected] Antti Antero Mero Department of Biology and Physical Activity, University of Jyväskylä Jyväskylä, Finland [emailprotected]

Svetlana M. Molchanova Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Mikio Nakazawa Department of Medical Technology School of Health Sciences Faculty of Medicine Niigata University Niigata, Japan [emailprotected] Naoyoshi Ogawa Taisho Pharmaceutical Co, Ltd Tokyo, Japan [emailprotected] Simo S. Oja Center for Laboratory Medicine Tampere University Hospital Tampere, Finland [emailprotected] James E. Olson Department of Neuroscience, Cell Biology and Physiology Wright State University School of Medicine Dayton, OH, USA [emailprotected]

PARTICIPANTS

Mitri Palmi Dipartimento di Scienze Biomediche Università di Siena Siena, Italy [emailprotected] Taesun Park Department of Food and Nutrition Yonsei University Seoul, South Korea [emailprotected] Levon Poghosyan Buniatian Institute of Biochemistry National Academy of Sciences Yerevan, Armenia [emailprotected] Pasi Puumala Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Sirpa Rainesalo Department of Neurology University of Tampere Tampere, Finland [emailprotected] Yudhachai Rajtasereekul Osotspa Co, Ltd Bangkok, Thailand [emailprotected] Sanya Roysommuti Department of Physiology Faculty of Medicine Khon Kaen University Khon Kaen, Thailand [emailprotected]

Chaichan Sangdee Department of Pharmacology Faculty of Medicine Chiang Mai University Chiang Mai, Thailand [emailprotected] Nikolay Sapronov Research Institute of Experimental Medicine Russian Academy of Medical Sciences St.Petersburg, Russia [emailprotected] Pirjo Saransaari Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Stephen W. Schaffer Department of Pharmacology University of South Alabama Mobile, AL, USA [emailprotected] David B. Shennan Hannah Research Institute Ayr, Scotland [emailprotected] Jose M. Solís Servicio de Neurobiología Hospital Ramón y Cajal Madrid, Spain [emailprotected] Ruzanna Stepanyan Heratsi Yerevan State Medical University,Yerevan, Armenia [emailprotected]

xii

Martha Stipanuk Division of Nutritional Sciences Cornell University Ithaca, NY, USA [emailprotected] Kyoko Takahashi Department of Clinical Evaluation of Medicines and Therapeutics Graduate School of Pharmaceutical Sciences Osaka University Osaka, Japan [emailprotected] Teisuke Takahashi Medicinal Research Laboratories Taisho Pharmaceutical Co, Ltd Tokyo, Japan [emailprotected] Andrey Taranukhin Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Yoriko Uozumi Clinical Evaluation of Medicines and Therapeutics Graduate School of Pharmaceutical Sciences Osaka University Osaka, Japan [emailprotected]

PARTICIPANTS

Vince Varga Brain Research Center Medical School University of Tampere Tampere, Finland [emailprotected] Roberta Ward Unite de Biochimie Universitè Catholique de Louvain Louvain-la-Neuve, Belgium [emailprotected] Michal Wegrzynowicz Department of Neurotoxicology Medical Research Centre Polish Academy of Sciences Warsaw, Poland [emailprotected] Fei Zhou Department of Integrative Medicine Shanghai Medical College Fudan University Shanghai, China [emailprotected]

CONTENTS Part 1. Taurine Metabolism and Taurine Transporter Metabolism of Taurine in Microorganisms: A Primer in Molecular Biodiversity? .............................................................................3 Alasdair M. Cook and Karin Denger The Reactivity of Hypotaurine and Cysteine Sulfinic Acid with Peroxynitrite ..................................................................................15 Mario Fontana, Silvestro Duprè, and Laura Pecci Cysteamine Dioxygenase: Evidence for the Physiological Conversion of Cysteamine to Hypotaurine in Rat and Mouse Tissues .....................25 Relicardo M. Coloso, Lawrence L. Hirschberger, John E. Dominy, Jeong-In Lee, and Martha H. Stipanuk In Vivo Regulation of Cysteine Dioxygenase via the Ubiquitin-26S Proteosome System................................................................................37 John E. Dominy, Jr., Lawrence L. Hirschberger, Relicardo M. Coloso, and Martha H. Stipanuk Osmosensitive Gene Expression of Taurine Transporter and Cyclin C in Embryonic Fibroblast Cells...............................................................49 Changkyu Oh, Yun Jaie Choi, Hyung Gee Kim, and Dong-Hee Lee Is TauT an Anti-Apoptotic Gene?.................................................................................59 Xiaobin Han and Russell W. Chesney Gene Expressions of Taurine Transporter and Taurine Biosynthetic Enzyme during Mouse and Chicken Embryonic Development ................................................................................69 Ha Won Kim, Seung Hyun Yoon, Taesun Park, Byong Kak Kim, Kun Koo Park, and Dong Hee Lee

xiii

xiv

CONTENTS

Mechanisms of Regulation of Taurine Transporter Activity: A Complex Interplay of Regulatory Systems ..............................................................79 Xiaobin Han and Russell W. Chesney TauT Gene Expression Is Regulated by TonEBP and Plays a Role in Cell Survival ..................................................................91 Takashi Ito, Yasushi Fujio, Yoriko Uozumi, Takahisa Matsuda, Makiko Maeda, Kyoko Takahashi, and Junichi Azuma Multiple PLA2 Isoforms Regulate Taurine Release in NIH3T3 Mouse Fibroblasts ........................................................................99 Ian Henry Lambert and Stine Falsig Pedersen Properties of Volume-Activated Taurine Efflux from Human Breast Cancer Cells ............................................................................. 109 David B. Shennan, Jean Thomson, James Davidson and Iain F. Gow

Part 2. Metabolic Effects of Taurine Taurine-Induced Changes in Transcription Profiling of Metabolism-Related Genes in Human Hepatoma Cells HepG2 ............................. 119 Sung-Hee Park, Haemi Lee, Kun Koo Park, Ha Won Kim, Dong Hee Lee, and Taesun Park The Important Role of Taurine in Oxidative Metabolism ...................................... 129 Svend Høime Hansen, Mogens Larsen Andersen, Henrik Birkedal, Claus Cornett, and Flemming Wibrand Characterization of Taurine as Inhibitor of Sodium Glucose Transporter ................................................................................. 137 HaWon Kim, Alexander John Lee, Seungkwon You, Taesun Park, and Dong Hee Lee Taurine Attenuates Pyridoxal-Induced Adrenomedullry Catacholamine Release and Glycogenolysis in the Rat ............................................ 147 Jagir P. Patel and Cesar A. Lau-Cam Cytotoxicity of Taurine Metabolites Depends on the Cell Type ............................. 157 Ewa Kontny, Magdalena ChorąĪy-Massalska, Weronika Rudnicka, Janusz Marcinkiewicz, and Wáodzimierz MaĞliĔski Effects of Dietary Salt and Fat on Taurine Excretion in Healthy and Diseased Rats ..................................................................................... 173 Mahmood S. Mozaffari, Rafik Abdelsayed, Champa Patel, and Stephen W. Schaffer

CONTENTS

Clinical Significance of Plasma Taurine Part I. Plasma Taurine Reflects Sympathetic Tone ....................................................... 181 Part II . Spontaneously High Plasma Taurine Concentration Presages Bad Outcome If Challenged with Ischemia ................................................................. 188 Tadaomi A. Miyamoto and Masumi R. Miyamoto Effects of Taurine on mRNA Levels of Nuclear Receptors and Factors Involved in Cholesterol and Bile Acid Homeostasis in Mice ............................................................................ 193 Nien Vinh Lam, Wen Chen, Kazuhito Suruga, Naomichi Nishimura, Toshinao Goda, Hiroaki Oda, and Hidehiko Yokogoshi Comparison of the Effects of Taurine with Those of Related Sulfur-Containing Compounds on Pyridoxal-Induced Adrenomedullary Cateholamine Release and Glycogenolysis in the Rat ...................................................................... 203 Cesar A. Lau-Cam and Jagir P. Patel Accumulation of Taurine in Tumor and Inflammatory Lesions ................................................................................................. 213 Chaekyun Kim

Part 3. Effects of Taurine Supplementation Effects of Garlic Powder and Taurine Supplementation on Abdominal Fat, Muscle Weight, and Blood Amino Acid Pattern in Ovariectomized Rats ........................................................... 221 Sun Hee Cheong, Chai Hyeock Yu, Mi-Ja Choi, and Kyung Ja Chang Effects of Garlic Powder and Soy Protein Supplementation on Blood Lipid Profiles and Amino Acid Concentrations in Postmenopausal Hyperlipidemic Model Rats ....................................................... 227 Sun Hee Cheong, Mi-Ja Choi, and Kyung Ja Chang The Effect of Dietary Taurine Supplementation on Plasma and Liver Lipid Concentrations and Free Amino Acid Concentrations in Rats Fed a High-Cholesterol Diet ............................................... 235 Mi-Ja Choi, Jung-Hee Kim, and Kyung Ja Chang The Effect of Dietary Taurine Supplementation on Plasma and Liver Lipid Concentrations and Mineral Metabolism in Rats Fed Alcohol ................................................................. 243 Mi-Ja Choi, Min-Ji Kim, and Kyung Ja Chang

xvi

CONTENTS

Effects of Taurine Supplementation on Cholesterol Levels with Potential Ramification in Atherosclerosis ........................................................ 251 John B. Lombardini and Julius D. Militante

Part 4. Taurine in Heart and Muscles Molecular Mechanisms of Cardioprotection by Taurine on Ischemia-Induced Apoptosis in Cultured Cardiomyocytes ................................ 257 Kyoko Takahashi, Tomoka Takatani, Yoriko Uozumi, Takashi Ito, Takahisa Matsuda, Yasushi Fujio, Stephen W. Schaffer, and Junichi Azuma Myogenic Induction of Taurine Transporter Prevents Dexamethasone-Induced Muscle Atrophy ................................................................ 265 Yoriko Uozumi, Takashi Ito, Kyoko Takahashi, Takahisa Matsuda, Tomomi Mohri, Yasushi Kimura,Yasushi Fujio, and Junichi Azuma Regionally Perfused Taurine Part I. Minimizes Lactic Acidosis and Preserves CKMB and Myocardial Contractility after Ischemia/Reperfusion ............................................ 271 Part II. Taurine Addition to St Thomas’ Solution Prevents DNA Oxidative Stress and Maintains Contractile Function .......................................... 279 Wnimunk Oriyanhan, Tadaomi A. Miyamoto, Kazuhiro Yamazaki, Senri Miwa, Kiyoaki Takaba, Tadashi Ikeda, and Masashi Komeda

Part 5. Taurine in Brain and Retina The Effect of Oxidative Stress on the Transport of Taurine in an in Vitro Model of the Blood Brain Barrier ........................................ 291 Young-Sook Kang Neuroprotection by Taurine and Taurine Analogues .............................................. 299 Roberta Ward, Tanya Cirkovic-Vellichovia, Florence Ledeque, Gunars Tirizitis, Gunars Dubars, Krishna Datla, David Dexter, Paul Heushling, and Robert Crichton Taurine Transporter Regulation in Hippocampal Neurons .................................... 307 James E. Olson and Eduardo Martinho, Jr. Taurine and Brain Excitability .................................................................................. 315 Abdeslem El Idrissi

CONTENTS

xvii

Systematically Administered Taurine Part I. Central Nervous System Effects ......................................................................... 323 Koho J. Miyamoto, Masumi R. Miyamoto, and Tadaomi A. Miyamoto Part II. Systematically Administered Taurine Protects in Hypothermia and Normothermia ................................................................ 330 Tadaomi A. Miyamoto, Koho J. Miyamoto, and Masumi R. Miyamoto Part III. Systemically Administered Taurine: Pharmacologically Activated Mechanisms ................................................................... 335 Tadaomi A. Miyamoto, Koho J. Miyamoto, and Masumi R. Miyamoto Effects of Taurine on Cerebral Blood Flow Perfusion, Cell Apoptosis, and Infarct Volume in Acute Cerebral Ischemic Rats ........................... 353 Fei Zhou, Jingchun Guo, Ru Yang, Jing Gu, Hongbin Jin, Gencheng Wu, and Jieshi Cheng The Mechanisms of Taurine’s Protective Action against Acute Guanidino Neurotoxicity .................................................................... 359 R. O. Law Properties of Basal Taurine Release in the Rat Striatum in Vivo ........................... 365 Svetlana M. Molchanova, Simo S. Oja, and Pirjo Saransaari Neuroprotective Mechanisms of Taurine in Vivo ..................................................... 377 Elmira Anderzhanova, Pirjo Saransaari, and Simo S. Oja Taurine Participates in the Anticonvulsive Effect of Electroacupuncture ..................................................................................... 389 Ru Yang, Qing Li, Jing-Chun Guo, Hong-Bing Jin, Jun Liu, Bu-Er Wang, and Jie-Shi Cheng Involvement of Taurine in Cerebral Ischemia and Electroacupuncture Anti-Ischemia ............................................................................ 395 Jingchun Guo, Peng Zhao, Yan Xia, Fei Zhou, Ru Yang, and Jieshi Cheng Mechanisms of Long-Lasting Enhancement of Corticostriatal Neurotransmission by Taurine ........................................................ 401 Aisa N. Chepkova, Olga A. Sergeeva, and Helmut L. Haas Increased GAD-Positive Neurons in the Cortex of Taurine-Fed Mice ............................................................................ 411 Natalia Levinskaya, Ekkhart Trenkner, and Abdeslem El Idrissi Taurine Concentration in Human Gliomas and Meningiomas: Tumoral, Peritumoral, and Extratumoral Tissue .................................................... 419 Suzana Cubillos, Francisco Obregón, María Fernanda Vargas, Luis Antonio Salazar, and Lucimey Lima

xviii

CONTENTS

Taurine Transport and Transporter Localization in Peripheral Blood Lymphocytes of Controls and Major Depression Patients .................................................................................. 423 Fili Fazzino, Mary Urbina, Salvador Mata, and Lucimey Lima Retina and Optic Tectum Interact to Modulate Taurine Effect on Goldfish and Rat Retinal Explants Outgrowth ........................................ 427 Lucimey Lima and Suzana Cubillos Neuritic Outgrowth from Goldfish Retinal Explants, Interaction of Taurine and Zinc ................................................................................ 435 Sonia Nusetti, Francisco Obregón, and Lucimey Lima

Part 6. Taurine Derivatives Taurine, Taurine Analogues, and Taurine Functions: Overview ........................... 443 L. Bianchi, M .A. Colivicchi, C. Ballini, M. Fattori, C. Venturi, M. G. Giovannini, J. Healy, K.. F. Tipton, and L. Della Corte Taurine Analogues and Taurine Transport: Therapeutic Advanges ..................... 449 R. C. Gupta Taurine, Taurine Analogues, and Mitochondrial Function and Dysfunction .......................................................................................... 469 M. Palmi, G. Davey, K. F. Tipton, and A. Meini Anti-Inflammatory Effects of Taurine Derivatives (Taurine Chloramine, Taurine Bromamine, and Taurolidine) Are Mediated by Different Mechanisms ................................................................... 481 Janusz Marcinkiewicz, Maria Kurnyta, Rafaá BiedroĔ, Maágorzata Bobek, Ewa Kontny, and Wáodzimierz MaĞliĔski Taurine Chloramine Inhibits the Production of Nitric Oxide and Superoxide Anion by Modulating Specific Mitogen-Activated Protein Kinases ............................................................. 493 Chaekyun Kim, Hyung Sim Choi, and Jun Woo Kim Anti-Neurotoxic Effects of Tauropyrone, a Taurine Analogue ..................................................................................................... 499 Vija Klusa, Linda Klimaviciusa, Gunars Duburs, Janis Poikans, and Alexander Zharkovsky Taurinamide Derivatives – Drugs with the Metabolic Type of Action Minireview .................................................................................................................... 509 Nikolay S. Sapronov and Ludmila K. Gavrovskaya

CONTENTS

xix

Potential Antiatherosclerotic Drugs: Novel N-Substituted Taurinamide Derivatives ......................................................... 515 Nikolay S. Sapronov, Ludmila K. Khnychenko, Irina V. Okunevich, and Ludmila K. Gavrovskaya Antihypoxic Properties of Taurinamide Derivatives: The Experimental Study ............................................................................................. 523 Ludmila K. Gavrovskaya, Irina B. Krɭlova, Elena N. Selina, Albina F. Safonova, Natalia N. Petrova , and Nikolay S. Sapronov The Influence of a Taurinamide Derivative on Skin Wound Healing in Rats: The Experimental Study ............................................................................................. 529 Ludmila K. Gavrovskaya, Elena N. Selina, Olga M. Rodionova, Galina I. Nezhinskaya, and Nikolay S. Sapronov Cardioprotective Effect of Taurhythman: The Experimental Study ............................................................................................. 535 Irina B. Krylova, Nataliya R. Evdokimova, Ludmila K. Gavrovskaya, and Nikolay S. Sapronov Neuroprotective Effect of a New Taurinamide Derivative – Taurepar ................................................................................................ 543 Irina B. Krylova, Valentina V. Bulion, Ludmila K. Gavrovskaya, Elena N. Selina, Nataliya N. Kuznetzova, and Nikolay S. Sapronov Index ............................................................................................................................. 551

Part 1. Taurine Metabolism and Taurine Transporter

METABOLISM OF TAURINE IN MICROORGANISMS A Primer in Molecular Biodiversity? Alasdair M. Cook and Karin Denger∗

1. INTRODUCTION To those studying the roles of taurine in mammals, one starting point might be Huxtable’s review (Huxtable, 1992), in which about one page was devoted to a list of known and putative functions of the compound. Subsequent taurine meetings have added much to this picture. The review also supplies information for microbiologists; in the meantime, much has been learned about the roles of taurine in microbial metabolism, and I see it as my brief to introduce the facts of the matter, and to delineate fact and hypothesis. First of all, I would like to remind you that we are, from the point of view of weight, mainly eukaryotic. However, from the point of view of numbers, we are largely prokaryotic. To be here, we should be able to perform considerable academic feats involving e.g. nerve cells and taurine, but metabolically, we are dunces: we can excrete it or we can conjugate it and excrete it. It is prokaryotes, apparently the bacteria, which show brilliance in manipulating taurine. So be warned that we are about to jump from one biogeochemical cycle to the next. Please fasten your seatbelts! One of the first microbiologists to mention taurine was den Dooren de Jong in 1926 (den Dooren de Jong, 1926); he seems to have tested the compound as a source of nitrogen for growth, with success: we will return to the nitrogen cycle later. A key player was Kondo, who, with Shimamoto and Berk, set the scene for much of the present work in the carbon cycle by discovering sulfoacetaldehyde as a key intermediate (cited in Cook and Denger, 2002). Another key player is Kertesz (2000), who established the oxygenolytic desulfonation of taurine in the sulfur cycle. Mammals are used to aerobic conditions, but about half the biosphere (by weight) is anoxic, and many taurine utilizers grow under strictly anoxic conditions (Lie et al., 1998; Cook and Denger, 2002): be prepared for novel respirations and fermentations! ∗

Department of Biological Sciences, The University, D-78457 Konstanz, Germany.

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

A. M. COOK and K. DENGER

We are used to taurine being the major organic solute in mammals (Huxtable, 1992) but think of the consequences for bacteria. When I drive you to tears, you are excreting taurine to feed bacteria. When I drive you to the toilet, your fluid and solid contributions to the sewage plant contain taurine and conjugated taurine. When I drive you to appendicitis, the taurine could well be utilized by Bilophila wadsworthia from your gut canal. When you try to wash me out of your hair, you are using taurine derivatives to generate the mild foam. When you get caught in a spider’s web, one glue-auxiliary is taurine. And if you throw yourself into the ocean to escape, you will find taurine as an osmolyte in deep-sea creatures. At least one antibiotic, bulgecin A, is a taurine conjugate. Bacteria have many potential sources of taurine, but presumably usually at low concentrations.

2. TAURINE TRANSPORT INTO THE BACTERIAL CELL Sulfonation has been described as Nature’s way of keeping a compound on one side of a biological membrane (Graham et al., 2002): the permanent negative charge in the physiological pH-range prevents passive diffusion across biological membranes. I gather that mammals have a relatively simple transporter, TauT [TC 2.A.22.3.3], to move taurine across membranes. Characterized enzymes of taurine biotransformation in bacteria are usually soluble, intracellular enzymes, so transport into the cell is essential for bacteria to be able to utilize the compound. Bacteria seem to have complex transporters. The best-understood transport system for taurine is associated with the assimilation of taurine sulfur in Escherichia coli. This is a 3-component ATP-binding cassette transporter, i.e. an ABC transporter termed TauABC [TC 3.A.1.17.1] (Eichhorn et al., 2000). The authors used mutation analysis and complementation studies to confirm the function of all three components. TauA is a periplasmic binding protein, TauC is the permease and TauB is the ATPase. This system, certainly as hom*ologous genes and occasionally with further experimental support, is widespread in bacteria which utilize taurine sulfur for growth (Kertesz, 2001; Masepohl et al., 2001). We suspect that ABC transporters are also involved in the utilization of taurine as a carbon source. Currently the evidence is purely that of genes hom*ologous to tauABC in e.g. Sinorhizobium meliloti and Paracoccus pantotrophus, and clustered with other genes known or believed to be involved with taurine dissimilation (Brüggemann et al., 2004). A different multi-component system is also believed to be involved in taurine transport in e.g. Rhodobacter sphaeroides and Paracoccus denitrificans. This is a tripartite ATP-independent (TRAP) system [TC 2.A.56.4.1] whose genes, tauKLM, are clustered with other genes known or believed to be involved with taurine dissimilation (Brüggemann et al., 2004). There is, as yet, no experimental evidence for function, simply a sequence similarity to other TRAP transporters.

3. TWO ROUTES TO GENERATE SULFOACETALDEHYDE Taurine dehydrogenase (TDH) was discovered by Kondo’s group (Kondo et al., 1971) and it is still referred to officially as EC 1.4.99.2, which indicates how difficult the enzyme is to study. Brüggemann et al. (2004) have now established that the physiological

METABOLISM OF TAURINE IN MICROORGANISMS

electron acceptor is cytochrome c, so we presume that the enzyme may be reclassified as EC 1.4.2.- (Fig. 1). The membrane-bound enzyme has not been purified, and we have not yet confirmed our hypothesis that the tauXY-genes encode the structural proteins (Ruff et al., 2003; Brüggemann et al., 2004). Work is in progress to express the genes heterologously. In the meantime, we were forced to postulate that some taurine dehydrogenases (e.g. TauXY in Rhodopseudomonas palustris) require a native cytochrome c for activity, rather than bovine cytochrome c (Denger et al., 2004b). Weinitschke has confirmed this idea by adding cytochrome c, which she isolated from R. palustris, to crude extract of R. palustris, and obtaining deamination of taurine (manuscript in preparation).

Figure 1. Presumed pathway for the dissimilation of taurine in Paracoccus denitrificans NKNIS, and the corresponding genes. Inducible TDH (taurine dehydrogenase), Xsc (sulfoacetaldehyde acetyltransferase) and Pta (phosphotransacetylase) have been assayed and tauZ is transcribed inducibly. The abbreviation ThDP represents thiamine diphosphate. The fate of acetyl-CoA is shown as the Krebs cycle, but this masks the requirement for anaplerotic enzymes, which in the β-Proteobacteria would be the glyoxylate shunt. The nature of the anaplerotic pathway in many α-Proteobacteria (e.g. strain NKNIS) is still unknown.

An alternative route to sulfoacetaldehyde is taurine:pyruvate transaminase (Tpa) [EC 2.6.1.77] coupled to alanine dehydrogenase (Ald) [EC 1.4.1.1] (Shimamoto and Berk, 1980). The enzymes were first purified from Bilophila wadsworthia and sequenced (Laue and Cook, 2000a,b). More recently, the enzymes were purified from Rhodococcus spp. and sequenced (Denger et al., 2004a), but the organism in which the most complete pathway can be sketched is apparently Silicibacter pomeroyi, where it is derived from the

A. M. COOK and K. DENGER

genome sequence (Moran et al., 2004) (Fig. 2). Whereas there is a high degree of sequence hom*ology amongst the TauXY sequences (Brüggemann et al., 2004), there is considerable diversity amongst the Tpa sequences (not shown). One organism, at least Rhodobacter sphaeroides, seems to express both the TDH and the Tpa, which can be deduced from the genome sequence (Novak et al., 2004; Denger, 2005). Both reactions have been detected in Paracoccus pantotrophus as well (Mikosch et al., 1999; Brüggemann et al., 2004), but this has not yet been explored in detail.

Figure 2. The presumed degradative pathway for taurine in Silicibacter pomeroyiT, and the corresponding genes. This pathway is an example with an ABC transporter and a Tpa (taurine:pyruvate aminotransferase). Growth with taurine is quantitative (Denger, 2005). Inducible Ald (alanine dehydrogenase), Xsc (sulfoacetaldehyde acetyltransferase) and Sor (sulfite dehydrogenase) have been measured; neither Sor nor the sor-gene has been identified (Denger, 2005). The identity of the sulfate exporter (SPO3564) is hypothetical. The abbreviation ThDP represents thiamine diphosphate. The enzymes and transporters appear to be encoded by SPO0673-0676 (tpa to tauC), SPO3560-3562 (pta to tauR) and SPO0222 (ald).

4. SULFOACETALDEHYDE ACETYLTRANSFERASE The nature of the desulfonation reaction was identified only recently and shown to be representative for enzymes studied previously (Ruff et al., 2003). Sulfoacetaldehyde acetyltransferase (Xsc) [EC 2.3.3.15] is one of a newly recognized group of acetyltransferases in which the acetyl group is subject to isomerization during transfer.

METABOLISM OF TAURINE IN MICROORGANISMS

Otherwise it seems to be a fairly standard thiamine diphosphate-coupled enzyme, which has the great advantage, especially for anaerobes, of yielding a high-energy bond, acetyl phosphate (Figs. 1 and 2). The sulfonate group is released as sulfite. Several lines of evidence led us to hypothesize, and then to verify, this reaction. In part we discovered the phosphate-dependence of the reaction and in part the sequencing project yielded the neighbouring phosphotransacetylase gene (e.g. Figs. 1 and 2). Literature data pointed out the lability of acetyl phosphate under all sample work-up regimes used previously, so minor alterations in sampling brought dramatic changes in reactants, products and stoichiometry. The new reaction was established, a mechanism suggested (Cook and Denger, 2002) and the older version withdrawn by the Nomenclature Committee (NC-IUBMB). The enzyme has been found in α-, β-, γ - and δ-Proteobacteria as well as in high- and low-G+C-content Gram-positive bacteria. Up till now we have recognized three subgroups of the enzyme, each of which has been purified and sequenced, and we suspect the presence of either another subgroup or an alternative enzyme type which is unstable (in e.g. Bilophila wadsworthia) (Ruff et al., 2003; Brüggemann et al., 2004).

5. PHOSPHOTRANSACETYLASE The phosphotransacetylase (Pta) (phosphate acetyltransferase [EC 2.3.1.8]), which was first suggested from sequence data (see Chapter 4), could be detected as enzyme activity (Figs. 1 and 2) (Ruff et al., 2003). As yet, direct confirmation has not been provided that the assayed enzyme is the product of the gene sequence indicated in Figs. 1 and 2. Preliminary analyses of sequenced genomes indicate that there are at least two classes of Pta. Indeed, in rare cases we have been unable to assay a phosphotransacetylase. The current hypothesis for the latter observation is that we have the wrong assay conditions, or that a class of Pta is unstable. This problem still needs to be addressed.

6. THE FATE OF TAURINE CARBON Chapters 2-5 have given examples of aerobic dissimilation of taurine (e.g. the strict aerobe Silicibacter pomeroyi in Fig. 2). This is characterized by respiring about 50 % of the taurine to CO2 and converting the other 50 % to biopolymers in cells. A similar situation holds true in Fig. 1, where the same dissimilative enzymes function whether Paracoccus denitrificans NKNIS is respiring with O2 or with NO3- as the terminal electron acceptor. Under these conditions, the acetyl CoA will be processed via the Krebs cycle and an anaplerotic pathway. The latter is presumably the glyoxylate bypass in βProteobacteria, where the necessary genes are present in organisms with a sequenced genome (e.g. Burkholderia xenovorans LB400), or have been detected by direct assay (Denger and Cook, 2001). The nature of the anaplerotic pathway in several αProteobacteria is still unclear (Novak et al., 2004). A range of strictly anaerobic bacteria dissimilates taurine. There is a sulfite respiration in Bilophila wadsworthia and in several sulfate-reducing bacteria (Laue et al., 1997; Lie et al., 1998). There is one fermentation in Desulfonispora thiosulfatigenes, another in Desulforhopalus singaporensis (Denger et al., 1999; Lie et al., 1999). In all

A. M. COOK and K. DENGER

cases, the major fate of the taurine carbon is acetate; some organisms utilize the remaining carbon for biosynthesis of biopolymers. Where data are available, it would appear that taurine transaminase is used in these strict anaerobes to generate sulfoacetaldehyde. In very few cases has the presence of Xsc been confirmed (see Chapter 4). The enzyme that can be measured routinely in these organisms is Pta, but in this case it is accompanied by acetate kinase (Ack [EC 2.7.2.1]). We interpret this as conservation of energy by substrate level phosphorylation by Ack to yield ATP and the acetate, which is excreted by an unknown mechanism. Pta converts a portion of the acetyl phosphate generated by the often-putative Xsc to acetyl CoA for biosynthetic purposes.

7. THE FATE OF TAURINE NITROGEN DURING CARBON LIMITATION When bacteria dissimilate taurine carbon, the ammonium ion is released (Figs. 1 and 2). This ammonium ion is in excess of requirements: bacteria require some 10 mol carbon per mol nitrogen. During growth, some 80% of the ammonium ion is recovered in the growth medium, usually concomitantly with growth, while the remainder is found in cell material (Denger et al., 1997). The nature of the exporter is unknown, though an Amt protein (Khademi et al., 2004) might be appropriate.

8. THE MANY FATES OF TAURINE SULFUR The initial fate of taurine sulfur is always sulfite (Figs. 1 and 2), whether the organism is strictly anaerobic, facultatively anaerobic or strictly aerobic. The requirement of the cell for sulfur for biosynthetic purposes is negligible (about 1% of cell dry weight), so effectively all the sulfite remains to be processed. The strictly anaerobic bacteria, which dissimilate taurine, apparently do so to obtain sulfite. These organisms then carry out a sulfite respiration via sulfite reductase (Laue et al., 2001), and many of them excrete the sulfonate moiety as sulfide, although dismutation to sulfide and sulfate is known, as is the release of thiosulfate (Cook and Denger, 2002). In some ways, taurine can be considered as a non-toxic source of sulfite for these organisms (Laue et al., 2001). Sulfite can be regarded as a dual problem for facultative anaerobes and aerobes. In part there is the aspect of toxicity, and in part there is the problem of the osmotic pressure within the cell and the requirement to maintain constant conditions in the cell. The problem of toxicity seems to be solved largely by oxidizing the sulfite to sulfate (Cook and Denger, 2002). This simple answer masks a range of problems. Is sulfite dehydrogenase [EC 1.8.2.1] or sulfite oxidase [EC 1.8.3.1] involved? There appears to be no report of sulfite oxidase [EC 1.8.3.1] in bacteria. And how many different sulfite dehydrogenases are there? The characterized bacterial sulfite dehydrogenase (SorAB) is periplasmic (Kappler et al., 2000), which seems unsuitable to dispose of intracellular sulfite, and sorAB-like genes of high identity are not widespread in sequenced bacterial genomes. At least one other type of sulfite dehydrogenase is known (Reichenbecher et al., 1999), and we believe this type to be present in Silicibacter pomeroyi (Denger, 2005), which does not contain the sorAB-genes. A lot of questions remain to be answered here.

METABOLISM OF TAURINE IN MICROORGANISMS

The problem of homeostasis seems to be answered by sulfate exporters. We postulate that TauZ (Fig. 1) is a sulfate exporter (Rein et al., 2005), one of many, but proof is still needed. We hypothesize that SPO3564 (Fig. 2) is another sulfate exporter, again without experimental evidence.

9. TAURINE AS A SOLE SOURCE OF NITROGEN FOR BACTERIA It was clear from earlier work, e.g. Figs. 1 and 2, that taurine-nitrogen was used for growth. But what happens, should one supply a further source of carbon and allow the organism to utilize all the available nitrogen? We did this experiment with Rhodococcus opacus, and found that the complete dissimilative pathway for taurine was present and active (effectively as in Fig. 2), but that specific activity of the enzymes was reduced, presumably reflecting the lower requirement for nitrogen compared with carbon. No ammonium ion was released into the medium, so presumably the exporter was inactive (Denger et al., 2004a).

Sulfoacetate I

O -

SO3

NADH H+

Sulfoacetaldehyde dehydrogenase

NAD+ H 2O O

SO3

Sulfoacetaldehyde O

SO3

NADH H+

Isethionate dehydrogenase

NAD+ HO

S O3

Isethionat III HO

SO3

Figure 3. The major fates of carbon and sulfur when taurine is utilized as a sole source of nitrogen by different bacteria. Another fate is sulfate and CO2, but that was minor in the experiments (Weinitschke et al., 2005). Rhodopseudomonas palustris uses taurine dehydrogenase to generate sulfoacetaldehyde, sulfoacetaldehyde dehydrogenase to generate sulfoacetate and we hypothesize exporter I (Denger et al., 2004b). Acinetobacter calcoaceticus also uses taurine dehydrogenase to generate sulfoacetaldehyde, which is excreted quantitatively by putative exporter II (Weinitschke et al., 2005). Klebsiella oxytoca transaminates taurine to generate sulfoacetaldehyde, which is reduced by isethionate dehydrogenase, and the isethionate excreted by putative exporter III (Styp von Rekowski et al., 2005).

A. M. COOK and K. DENGER

Sequence data led us to test whether Rhodopseudomonas palstris utilized taurine nitrogen. It did so, but there was no excretion of sulfate, in contrast to the metabolism of Rhodococcus opacus. Instead, the organism excreted sulfoacetate quantitatively (Fig. 3). We thus had a new pathway to generate sulfoacetate, which was previously known only from the degradation of the plant sulfolipid (Denger et al., 2004b). Further exploration of this phenomenon showed that the release of an organosulfonate from taurine under these conditions was normal; only about 10% of isolates released sulfate (Weinitschke et al., 2005). One of the products formed was sulfoacetaldehyde: as the compound is utilized as a growth substrate by other bacteria (Lie et al., 1996), we presume that the excretion of sulfoacetaldehyde is not unusual. The third organosulfonate that we discovered in quantitative amounts was isethionate (Styp von Rekowski et al., 2005). The generation of isethionate from taurine in faecal material was known (Fellman et al., 1980), and those authors attribute mammalian isethionate to bacterial production in the gut. We now supply a physiological and biochemical background to that observation. Just as the excretion of sulfate requires an exporter, in our hypotheses (Chapter 8), we see a requirement for exporters of sulfoacetate, sulfoacetaldehyde and isethionate (Fig. 3). In the latter cases, however, there is even less experimental evidence that in Chapter 8.

10. REGULATION OF INDUCTION The utilization of taurine described in Chapters 2-9 involves regulation of enzyme induction. In almost all cases where we have data, a gene neighbouring a region encoding a recognized portion of the pathways in Figs. 1-3 is found in common. We have termed it the tauR-gene (Figs. 1 and 2), because of its similarity to known transcriptional regulators (Ruff et al., 2003; Brüggemann et al., 2004), but here again, we have not yet tested the hypothesis. The genome of Desulfotalea psychrophila (Rabus et al., 2004), with candidates for tauKLM, tpa, ald and xsc (see Figs. 1 and 2), contains no tauR-like gene, so a different regulatory protein or mechanism seems likely. The available evidence indicates that sulfite dehydrogenase is inducible. When an organism utilizes more than one inducible desulfonation pathway (e.g. Paracoccus pantotrophus NKNCYSA), the sulfite dehydrogenase is induced in both cases (Rein et al., 2005), which shows that the regulation of sulfite dehydrogenase is independent of the regulation of the degradation of sulfonates.

11. SCAVENGING FOR SULFUR UNDER GLOBAL REGULATION The requirement for sulfur for biomolecules is orders of magnitude lower than for e.g. carbon (Chapter 8). Correspondingly, different enzymes are needed under the different conditions of sulfur limitation and carbon limitation. Similarly, different regulation is required. Kertesz (2000) describes this in detail. The regulation is not the specific induction presumed in Chapter 10. Instead, there is global regulation, whereby the cell under sulfate starvation simultaneously switches on all scavenging systems it contains; sometimes, additional regulatory circuits are involved. One of those is for taurine.

METABOLISM OF TAURINE IN MICROORGANISMS

2-Oxoglutarate

Succinate + CO2

O2 -

H3N

SO3

H3N

TauABC Taurine

SO3

H3N

TauD HSO3-

Cellular organic sulfur

Figure 4. Desulfonation of taurine involving the products of the taurine cluster tauABCD, which was initially discovered in Escherichia coli (Eichhorn et al., 1997, 2000).

The taurine cluster contains four genes, tauABCD. The transporter, TauABC (Fig. 4), was introduced earlier (Chapter 2). The desulfonation is oxygenolytic (Fig. 4). Taurine dioxygenase (TauD [EC 1.14.11.17]) is a 2-oxoglutarate-dependent oxygenase, which generates sulfite, succinate and 2-aminoacetaldehyde. This system is very widespread in bacteria, as a search of the NCBI database with the BLAST algorithm and any of the protein sequences shows.

12. FINAL COMMENTS The degradative path for taurine is short, but it includes novel biochemistry and multiple transport and regulatory phenomena of general relevance, which are poorly understood and which we hope to elucidate. We are grateful to John Quinn (Queen’s University Belfast, Northern Ireland, UK) for sharing his understanding of sulfonate metabolism with us. The research was funded by the Deutsche Forschungsgemeinschaft, the University of Konstanz, the European Union (SUITE) and the LBS Stiftung ‘Umwelt und Wohnen’.

13. REFERENCES Brüggemann, C., Denger, K., Cook, A. M., and Ruff, J., 2004, Enzymes and genes of taurine and isethionate dissimilation in Paracoccus denitrificans, Microbiology (Reading) 150:805-816. Cook, A. M., and Denger, K., 2002, Dissimilation of the C2 sulfonates, Arch. Microbiol. 179:1-6. den Dooren de Jong, L. E. 1926, Bijdrage tot de kennis van het mineralisatieproces, Rotterdam: Nijgh and van Ditmar. Denger, K., 2005, Unpublished data. Denger, K., and Cook, A. M. 2001, Ethanedisulfonate is degraded via sulfoacetaldehyde in Ralstonia sp. strain EDS1, Arch. Microbiol. 176:89-95. Denger, K., Laue, H., and Cook, A. M., 1997, Anaerobic taurine oxidation: a novel reaction by a nitratereducing Alcaligenes sp, Microbiology (Reading) 143:1919-1924. Denger, K., Ruff, J., Schleheck, D., and Cook, A. M., 2004, Rhodococcus opacus expresses the xsc gene to utilize taurine as a carbon source or as a nitrogen source but not as a sulfur source, Microbiology (Reading) 150:1859-1867.

A. M. COOK and K. DENGER

Denger, K., Stackebrandt, E., and Cook, A. M., 1999, Desulfonispora thiosulfatigenes gen. nov., sp. nov., a widespread, taurine-fermenting, thiosulfate-producing, anaerobic bacterium, Int. J. Syst. Bacteriol. 49:1599-1603. Denger, K., Weinitschke, S., Hollemeyer, K., and Cook, A. M. 2004, Sulfoacetate generated by Rhodopseudomonas palustris from taurine, Arch. Microbiol. 182:254-258. Eichhorn, E., van der Ploeg, J. R., Kertesz, M. A., and Leisinger, T., 1997, Characterization of α-ketoglutaratedependent taurine dioxygenase from Escherichia col, J. Biol. Chem. 272:23031-23036. Eichhorn, E., van der Ploeg, J. R., and Leisinger, T., 2000, Deletion analysis of the Escherichia coli taurine and alkanesulfonate transport systems, J. Bacteriol. 182:2687-2795. Fellman, J. H., Roth, E. S., Avedovech, N. A., and McCarthy, K. D., 1980, The metabolism of taurine to isethionate, Arch. Biochem. Biophys. 204:560-567. Graham, D. E., Xu, H., and White, R. H., 2002, Identification of coenzyme M biosynthetic phosphosulfolactate synthase: a new family of sulfonate biosynthesizing enzymes, J. Biol. Chem. 277:13421-13429. Huxtable, R. J. 1992, Physiological actions of taurine, Physiol. Rev. 72:101-163. Kappler, U., Bennett, B., Rethmeier, J., Schwarz, G., Deutzmann, R., McEwan, A. G., and Dahl, C., 2000, Sulfite:cytochrome c oxidoreductase from Thiobacillus novellus. Purification, characterization, and molecular biology of a heterodimeric member of the sulfite oxidase family, J. Biol. Chem. 275:1320213212. Kertesz, M. A. 2000, Riding the sulfur cycle - metabolism of sulfonates and sulfate esters in Gram-negative bacteria, FEMS Microbiol. Rev. 24:135-175. Kertesz, M. A. 2001, Bacterial transporters for sulfate and organosulfur compounds, Res. Microbiol. 152:279290. Khademi, S., O’Connell, J., 3rd, Remis, J., Robles-Colmenares, Y., Miercke, L. J., and Stroud, R. M., 2004, Mechanism of ammonia transport by Amt/MEP/Rh: structure of AmtB at 1.35 A, Science (Washington, DC) 305:1587-1594. Kondo, H., Anada, H., Ohsawa, K., and Ishimoto, M.,1971, Formation of sulfoacetaldehyde from taurine in bacterial extracts, J. Biochem. 69:621-623. Laue, H. and Cook, A. M., 2000, Biochemical and molecular characterization of taurine:pyruvate aminotransferase from the anaerobe Bilophila wadsworthia, Eur. J. Biochem. 267:6841-6848. Laue, H. and Cook, A. M., 2000, Purification, properties and primary structure of alanine dehydrogenase involved in taurine metabolism in the anaerobe Bilophila wadsworthia, Arch. Microbiol. 174:162-167. Laue, H., Denger, K., and Cook, A. M., 1997, Taurine reduction in anaerobic respiration of Bilophila wadsworthia RZATAU, Appl. Environ. Microbiol. 63:2016-2021. Laue, H., Friedrich, M., Ruff, J., and Cook, A. M., 2001, Dissimilatory sulfite reductase (desulfoviridin) of the taurine-degrading, non-sulfate-reducing bacterium Bilophila wadsworthia RZATAU contains a fused DsrB-DsrD subunit, J. Bacteriol. 183:1727-1733. Lie, T. J., Clawson, M. L., Godchaux, W., and Leadbetter, E. R., 1999, Sulfidogenesis from 2aminoethanesulfonate (taurine) fermentation by a morphologically unusual sulfate-reducing bacterium, Desulforhopalus singaporensis sp. nov, Appl. Environ. Microbiol. 65:3328-3334. Lie, T. J., Pitta, T., Leadbetter, E. R., Godchaux III, W., and Leadbetter, J. R., 1996, Sulfonates: novel electron acceptors in anaerobic respiration, Arch. Microbiol. 166:204-210. Lie, T. L., Leadbetter, J. R., and Leadbetter, E. R., 1998, Metabolism of sulfonic acids and other organosulfur compounds by sulfate-reducing bacteria, Geomicrobiol. Rev. 15:135-149. Masepohl, B., Führer, F., and Klipp, W., 2001, Genetic analysis of a Rhodobacter capsulatus gene region involved in utilization of taurine as a sulfur source, FEMS Microbiol. Lett. 205:105-111. Mikosch, C., Denger, K., Schäfer, E.-M., and Cook, A. M., 1999, Anaerobic oxidations of cysteate: degradation via a cysteate:2-oxoglutarate aminotransferase in Paracoccus pantotrophus, Microbiology (Reading) 145:1153-1160. Moran, M. A., Buchan, A., González, J. M., Heidelberg, J. F., Whitman, W. B., Klene, R. P., Henriksen, J. R., King, G. M., Belas, R., Fuqua, C., Brinkac, L., Lewis, M., Johri, S., Weaver, B., Pal, G., Eisen, J., Rahe, E., Sheldon, W. M., Ye, W., Miller, T. R., Carlton, J., Rasko, D. A., Paulsen, I. T., Ren, Q., Dougherty, S. C., DeBoy, R. T., Dobson, R. J., Durkin, A. S., Madupu, R., Nelson, W. C., Sullivan, S. A., Rosovitz, M. J., Haft, D. H., Selengut, J., and Ward, N., 2004, Genome sequence of Silicibacter pomeroyi reveals adaptations to the marine environment, Nature (London) 432:910-913. Novak, R. T., Gritzer, R. F., Leadbetter, E. R., and Godchaux, W., 2004, Phototrophic utilization of taurine by the purple nonsulfur bacteria Rhodopseudomonas palustris and Rhodobacter sphaeroides, Microbiology (Reading) 150:1881-1891.

METABOLISM OF TAURINE IN MICROORGANISMS

Rabus, R., Ruepp, A., Frickey, T., Rattei, T., Fartmann, B., Stark, M., Bauer, M., Zibat, A., Lombardot, T., Becker, I., Amann, J., Gellner, K., Teeling, H., Leuschner, W. D., Glöckner, F.-O., Lupas, A. N., Amann, R., and Klenk, H.-P., 2004, The genome of Desulfotalea psychrophila, a sulfate-reducing bacterium from permanently cold Arctic sediments, Environ. Microbiol. 6:887-902. Reichenbecher, W., Kelly, D. P., and Murrell, J. C., 1999, Desulfonation of propanesulfonic acid by Comamonas acidovorans strain P53: evidence for an alkanesulfonate sulfonatase and an atypical sulfite dehydrogenase, Arch. Microbiol. 172:387-392. Rein, U., Gueta, R., Denger, K., Ruff, J., Hollemeyer, K., and Cook, A. M., 2005, Dissimilation of cysteate via 3-sulfolactate sulfo-lyase and a sulfate exporter in Paracoccus pantotrophus NKNCYSA, Microbiology (Reading) 151:737-747. Ruff, J., Denger, K., and Cook, A. M., 2003, Sulphoacetaldehyde acetyltransferase yields acetyl phosphate: purification from Alcaligenes defragrans and gene clusters in taurine degradation, Biochem. J. 369:275. Shimamoto, G. and Berk, R. S., 1980, Taurine catabolism II. Biochemical and genetic evidence for sulfoacetaldehyde sulfo-lyase involvement, Biochim. Biophys. Acta 632:121-130. Styp von Rekowski, K., Denger, K., and Cook, A. M., 2005, Isethionate as a product from taurine during nitrogen-limited growth of Klebsiella oxytoca TauN1, Arch. Microbiol. 183:325-330. Weinitschke, S., Styp von Rekowski, K., Denger, K., and Cook, A. M., 2005, Sulfoacetaldehyde is excreted quantitatively by Acinetobacter calcoaceticus SW1 during growth with taurine as sole source of nitrogen, Microbiology (Reading) 151:1285-1290.

THE REACTIVITY OF HYPOTAURINE AND CYSTEINE SULFINIC ACID WITH PEROXYNITRITE∗ Mario Fontana, Silvestro Duprè, and Laura Pecci∗∗ 1. INTRODUCTION The oxidation of the sulfinic group of both hypotaurine and cysteine sulfinic acid with production of the respective sulfonate, taurine and cysteic acid is a crucial point for the generation of taurine in mammalian tissues (Wright et al., 1986; Huxtable, 1992). It has been proposed that the high levels of taurine found in tissues or cells such as sperm, neutrophils and retinal tissue (Pasantes-Morales et al., 1972; Alvarez and Storey, 1983; Learn et al., 1990; Green et al., 1991; Holmes et al., 1992) would reflect the turnover of hypotaurine via oxidative reactions and might be viewed as an indirect measure of the oxidative stress associated with such tissues. However, the mechanism of the oxidative reaction of the sulfinic group is not yet clearly defined. Recently, it has been shown that, besides nonspecific oxidants such as UV irradiation, hypochlorite, hydroxyl radical and photochemically generated singlet oxygen, also peroxynitrite mediates the oxidation of both hypotaurine and cysteine sulfinic acid to taurine and cysteic acid, respectively (Ricci et al., 1978; Green et al., 1985; Fellman et al., 1987; Pecci et al., 1999; Fontana et al., 2005). These findings have been related to the proposed role of hypotaurine as an antioxidant and free radical trapping agent in vivo (Aruoma et al., 1988; Tadolini et al., 1995). According to this, hypotaurine and cysteine sulfinic acid are able to prevent peroxynitrite-mediated reactions such as tyrosine nitration, α1-antiproteinase inactivation and low-density lipoprotein oxidative modification (Fontana et al., 2004). Peroxynitrite is a strong oxidizing and nitrating agent, which can be produced by the reaction of nitric oxide with superoxide anion (Koppenol et al., 1992; Huie and Padmaja, 1993; Pryor and Squadrito, 1995) and represents a reactive toxic species that can mediate cellular and tissue damage in various human diseases, including neurodegenerative disorders, inflammatory and autoimmune diseases (Eiserich et al., 1998; Stewart and Heales, 2003). At physiological pH both peroxynitrite anion (ONOO–) and its conjugate ∗

Dedicated to Professor Doriano Cavallini (1916-2005). Dipartimento di Scienze Biochimiche, Università di Roma “La Sapienza”, Roma, Italy; Istituto di Biologia e Patologia Molecolari, Consiglio Nazionale delle Ricerche, Roma, Italy.

∗∗

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

M. FONTANA ET AL.

acid (ONOOH, pKa = 6.8) are present. Peroxynitrite is quite stable but upon protonation to peroxynitrous acid; it decays rapidly (t1/2 < 1 s) generating nitrate together with highly oxidizing and nitrating reactive species. It has been reported that peroxynitrite can oxidize suitable substrates, either through a direct one- or two-electron mechanism or by an indirect one-electron reaction involving hydroxyl (•OH) and nitrogen dioxide (•NO2) radicals released during peroxynitrite hom*olysis (Radi et al., 2001). In a recent work, the reaction of the sulfinates, hypotaurine and cysteine sulfinic acid with peroxynitrite has been shown to be associated with extensive oxygen uptake, suggesting that hypotaurine and cysteine sulfinic acid are oxidized by one-electron transfer mechanism to sulfonyl radicals which are converted to sulfonates by further oxygen-dependent reactions (Fontana et al., 2005). Beside the one-electron mechanism, hypotaurine and cysteine sulfinic acid can be oxidized by the two-electron pathway leading to direct sulfonate formation without oxygen consumption. The oxidation of sulfinates by peroxynitrite may thereby occur via the two reaction pathways. In order to evaluate the mechanisms of oxidation of sulfinates by peroxynitrite and the relevance of the one- and the two-electron oxidative pathways, we compared oxygen consumption and sulfonate production at various concentrations of the two sulfinates. Peroxynitrite decomposition produces nitrate as main product while after reaction with a target molecule nitrite, whose quantity depends on the pathway of the oxidative reaction, is formed (Kissner and Koppenol, 2002; Jourd’heuil et al., 2003). Therefore, the amount of nitrite and nitrate formed in the reaction of peroxynitrite with hypotaurine and cysteine sulfinic acid at different pH has been also determined.

2. MATERIALS AND METHODS 2.1. Chemicals Cysteine sulfinic acid, cysteic acid, hypotaurine, taurine were obtained from Sigma Chem Co. Diethylenetriamine pentaacetic acid (DTPA), tetrabutylammonium bisulfate, o-phthaldialdehyde and manganese dioxide were from Fluka. All other reagents were of the highest purity commercially available. Peroxynitrite was synthesized from potassium nitrite and hydrogen peroxide under acidic conditions as previously described (Beckman et al., 1994), and excess hydrogen peroxide was removed by treatment with granular manganese dioxide. Typical peroxynitrite concentration after freeze fractionation was 600-700 mM as determined by absorbance at 302 nm using a molar absorption coefficient of 1670 M–1cm–1. Stock solutions of peroxynitrite were diluted with 0.1 M NaOH immediately before use to achieve the desired concentration. 2.2. Reaction of Hypotaurine or Cysteine Sulfinic Acid With Peroxynitrite The reaction mixture contained hypotaurine or cysteine sulfinic acid at appropriate concentrations in 0.2 M phosphate buffer at pH 7.4 or 5.5. To avoid metal-catalyzed oxidative reactions, all samples contained 0.1 mM DTPA. The reaction was started by addition of peroxynitrite at a final concentration of 0.2 mM. To control for nonspecific effects of contaminating substances present in the peroxynitrite solutions or to stable peroxynitrite-decomposition products (nitrite and nitrate), peroxynitrite was first incubated

REACTIVITY OF HYPOTAURINE WITH PEROXYNITRITE

in phosphate buffer/DTPA for 10 min before the addition of hypotaurine or cysteine sulfinic acid (reverse order addition). 2.3. Oxygen Uptake Oxygen uptake was performed using a Gilson 5/6 oxygraph and measured with a Clark type electrode in a water-jacketed cell (1.8 ml) at 25°C. The saturation oxygen concentration at this temperature was taken as 235 µM. 2.4. HPLC Analysis Hypotaurine, cysteine sulfinic acid, taurine and cysteic acid were determined by high performance liquid chromatography (HPLC) using the o-phthaldialdehyde reagent (Hirschberger et al., 1985). Analyses were carried out with a Waters Chromatograph equipped with a Perkin-Elmer model LS-1 LC fluorescence detector using a 340-nm filter for excitation with an emission wavelength of 450 nm. The column was a 250 x 4.6 mm I.D. Simmetry C18, 5 µm (Waters). The mobile phases were (A) 0.05 M sodium acetate (pH 5.5)-metanol (80:20, v/v) and (B) 0.05 M sodium acetate (pH 5.5)-metanol (20:80, v/v). The elution gradient was linear from A to 50% B in 5 min followed by isocratic at 50% B. Flow rate was 1 ml/min at room temperature. The elution times of cysteic acid, cysteine sulfinic acid, taurine and hypotaurine were 7.5, 10.5, 24.5, and 26 min, respectively. Nitrite and nitrate were analyzed by ion-pairing HPLC as described previously (Jourd’heuil et al., 2003). Samples were injected onto a 250 x 4.6 mm I.D. Atlantis C18, 5 µm (Waters) isocratically running at a flow rate of 1 ml/min with 10 mM K2HPO4, 10 mM tetrabutylammonium bisulfate in water-acetonitrile (95:5, v/v, pH 7). Detection was made at 210 nm using a Waters 996 photodiode array detector. The elution times of nitrite and nitrate were 8.5 and 20.5 min, respectively. 2.5. Statistical Analysis Results are expressed as mean values ± SEM of at least three separate experiments. Graphics and data analysis were performed using GraphPad Prism 4 software.

3. RESULTS AND DISCUSSION 3.1. Peroxynitrite-Mediated Oxidation of Hypotaurine and Cysteine Sulfinic Acid The oxidation of the sulfinates, hypotaurine and cysteine sulfinic acid, by peroxynitrite has been evaluated by monitoring the oxygen consumption and the production of the corresponding sulfonates, taurine and cysteic acid, at physiological pH. When peroxynitrite is added to a solution containing the sulfinates (RSO2–), fast oxygen consumption is observed, suggesting the generation of intermediate radicals which react with oxygen. It is therefore proposed that the peroxynitrite-mediated oxidation of sulfinates probably involves an initial one-electron transfer mechanism with generation of sulfonyl radical (RSO2•). Despite the controversial aspect of peroxynitrite chemistry, presently most investigators agree that one-electron oxidation is not a direct

M. FONTANA ET AL.

reaction of peroxynitrite but depends on the interaction of the target molecule with the nitrogen dioxide (•NO2) and hydroxyl radicals (•OH) released during the degradation process of peroxynitrite (Radi et al., 2001). According to this, the sulfinates can be indirectly oxidized to sulfonyl radicals by the peroxynitrite-derived free radicals: RSO2–

•

OH/•NO2

RSO2• +

OH–/NO2–

(1)

HPLC analyses of the incubation mixtures at the end of the reaction show that hypotaurine and cysteine sulfinic acid are oxidized to the corresponding sulfonates, taurine and cysteic acid.

Figure 1. Oxidation of hypotaurine and cysteine sulfinic acid by peroxynitrite at pH 7.4. Peroxynitrite (200 µM) was added into the oxygraph chamber at 25°C, containing (1 or 10 mM) hypotaurine (A) or cysteine sulfinic acid (B) in 0.2 M phosphate buffer and 0.1 mM DTPA, pH 7.4, and the O2 consumption was recorded. The reaction mixtures were subsequently analyzed by HPLC.

Fig. 1A shows oxygen uptake and the amount of taurine produced after the addition of 200 µM peroxynitrite to 1 mM and 10 mM hypotaurine at pH 7.4. It can be observed that at 10 mM hypotaurine, the amount of taurine produced is higher than the concentration of peroxynitrite added, evidencing the occurrence of a chain reaction mechanism responsible of amplification of the oxidation. Furthermore, the results show that the amount of oxygen consumed per mol of sulfonate produced is much lower at 10 mM hypotaurine. Fig. 1B shows oxygen uptake and the amount of cysteic acid produced by reacting cysteine sulfinic acid with peroxynitrite in the same experimental condition as above. It can be observed: (a) at 1 mM cysteine sulfinc acid concentration, the amount of oxygen uptake is much higher than cysteic acid produced; (b) at 10 mM cysteine sulfinic acid, the amount of oxygen uptake is lower than at 1 mM cysteine sulfinic acid; and (c) the yields of cysteic acid are lower when compared to taurine obtained after the reaction of peroxynitrite with hypotaurine under the same reaction conditions. These results can be explained by the already reported tendency of cysteine sulfinic acid-derived radical to decompose sulfur dioxide (SO2) produced and a carbon-centered radical (R•) (Harman et al., 1984). Subsequent oxidation of sulfite (aqueous sulfur dioxide) to sulfate involves additional free radical mechanisms leading to oxygen consumption (Mottley and Mason, 1988; Karoui et al., 1996). The previously reported detection of sulfate in the incubation mixtures of cysteine sulfinic acid with peroxynitrite indicates that cysteine sulfinic acid-

REACTIVITY OF HYPOTAURINE WITH PEROXYNITRITE

derived sulfonyl radical undergoes a significative decomposition at physiological pH 7.4 (Fontana et al., 2005). Accordingly, the high oxygen uptake, observed during the reaction of cysteine sulfinic acid with peroxynitrite, can account, in addition to that required for oxidation of cysteine sulfinic acid to cysteic acid, for the oxidation of sulfite to sulfate. It is also possible that the high reactive alkyl radical (R•) can react with oxygen, contributing to the observed oxygen uptake. Interestingly, compared to the cysteine sulfinic acid-derived sulfonyl radical, the sulfonyl radical derived from the oxidation of hypotaurine appears to have a much lower tendency to decompose as indicated by the finding that the amount of oxygen consumed per mole of taurine produced is much lower than that observed in the oxidation of cysteine sulfinic acid. The oxidative reactions mediated by peroxynitrite are expected to take place by both one- and two-electron mechanisms (Radi et al., 2001). As mentioned above, it is recognized that the one-electron mechanism is not a direct reaction of peroxynitrite but depends on the radicals •OH and •NO2 derived from peroxynitrite decomposition. In the two-electron mechanism, peroxynitrite reacts directly with the target molecule in an overall second-order process. Although the observed oxygen consumption associated with oxidation of sulfinates by peroxynitrite indicates a relevant contribution of the oneelectron pathway, the two-electron mechanism could represent an additional route of oxidation of sulfinates leading to direct sulfonate formation without oxygen consumption. The results that the oxygen consumed per mole of sulfonate produced decreases considerably with the increase of sulfinate concentration, indicate that the reaction may occur via the two mechanisms whose relative importance depends on reagent concentrations. At 1 mM RSO2– concentration, where the oxygen uptake associated with the oxidation of sulfinates is higher; the one-electron mechanism with the intermediate formation of sulfonyl radicals is likely to predominate. In this case, the radicals •OH and • NO2 produced during peroxynitrite decomposition oxidize RSO2– to RSO2• radicals which are responsible of oxygen consumption. Additionally, the formation of sulfonyl radicals initiates an oxygen-dependent radical chain reaction that could greatly amplify the importance of the one-electron pathway. At 10 mM RSO2– concentrations the oxygen uptake associated with the oxidation of sulfinates decreases, as the second-order reaction of the two sulfinates with peroxynitrite becomes more significant. In this pathway, peroxynitrite participates as two-electron oxidant and will oxidize the sulfinates without the formation of sulfonyl radicals, and thus with no associated oxygen consumption (see Scheme 1). 3.2. Effect of pH on the Interaction of Peroxynitrite With Sulfinates To evaluate the effect of pH on peroxynitrite-mediated oxidation of sulfinates, we monitored hypotaurine and cysteine sulfinic acid oxidation at pH 5.5 by sulfonate production and oxygen consumption. The data presented in Fig. 2 show that in the reaction of 1 mM sulfinates with 200 µM peroxynitrite at acidic pH, the yields of representive sulfonates are greater than those at pH 7.4. These data suggest that peroxynitrous acid (ONOOH, pKa = 6.8) is the reactive species. Kinetic experiments performed at various pH are consistent with this interpretation (Fontana et al., 2005). The oxygen uptake associated with the reaction carried out at pH 5.5 reveals a stoichiometry of approximately 0.5 mol of oxygen consumed per mol of sulfonate produced. These results indicate that at acidic pH, the cysteine sulfinic acid-derived sulfonyl radical appears to have a lower tendency to decompose.

M. FONTANA ET AL.

Figure 2. Oxidation of hypotaurine and cysteine sulfinic acid by peroxynitrite at pH 5.5. Peroxynitrite (200 µM) was added into the oxygraph chamber at 25°C, containing 1 mM hypotaurine (A) or 1 mM cysteine sulfinic acid (B) in 0.2 M phosphate buffer and 0.1 mM DTPA, pH 5.5, and the O2 consumption was recorded. The reaction mixtures were subsequently analyzed by HPLC.

3.3. Measurement of Nitrite and Nitrate During the Oxidation of Sulfinates by Peroxynitrite In the two-electron process of oxidation of sulfinate by peroxynitrite, nitrite and sulfonate would be the only products: RSO2–

+ ONOO–/ONOOH

RSO3–

NO2–

(2)

If sulfinates are oxidized by one-electron mechanism, also nitrate will be formed. This is because the peroxynitrite-derived radicals •OH and •NO2, initially formed in a solvent cage, undergo rapid recombination to form nitrate (about 70%) or escape the cage (about 30%) to give free radicals, which react with sulfinates (Mottley and Mason, 1988; Karoui et al., 1996). Thus, the product distribution of nitrite and nitrate can provide a further mean to establish the contribution of the two pathways.

Figure 3. Oxidation of hypotaurine and cysteine sulfinic acid by peroxynitrite: nitrite and nitrate formation. Peroxynitrite (200 µM) was incubated with different concentrations of hypotaurine (A) and cysteine sulfinic acid (B), in 0.2 M phosphate buffer containing 0.1 mM DTPA at room temperature for 15 min, followed by the determination of NO2– and NO3–.

REACTIVITY OF HYPOTAURINE WITH PEROXYNITRITE

The concentrations of nitrite and nitrate formed during the decomposition of the peroxynitrite at pH 7.4 and 5.5 in the presence of various concentrations of sulfinates are reported in Fig. 3. The increase of nitrite and the decrease of nitrate formed during the reaction of 200 µM peroxynitrite with increasing concentrations of sulfinates further support the conclusion that the two pathways coexist and that the direct reaction (i.e., two-electron oxidation) would prevail quantitatively over the one-electron oxidation when sulfinates are present in large excess over peroxynitrite. The unexpected low yield of nitrite observed in the reaction of peroxynitrite with cysteine sulfinic acid could be explained by a partial reoxidation of produced nitrite by secondary radicals generated by decomposition of the cysteine sulfinic acid-derived sulfonyl radicals.

4. CONCLUSION The data presented in this work demonstrate that the sulfinates (RSO2–), hypotaurine and cysteine sulfinic acid are oxidized by peroxynitrite to form the corresponding sulfonates (RSO3–), taurine and cysteic acid. The data demonstrate that the peroxynitritemediated oxidation of sulfinates may occur either through one- or two-electron pathways whose relative importance depends on reagent concentrations and pH. We propose that one-electron oxidation, mediated by the peroxynitrite-derived free radicals, produces sulfonyl radicals (RSO2•) as intermediates. The peroxynitrite-mediated oxidative pathways of sulfinates are shown in the scheme 1.

ONOO - + H

RSO2-

ONOOH

RSO3- + NO2-

. R

End products

H2O

NO2 + OH. RSO2-

RSO2

SO2

SO32 -

RSO2OO 1/2 O2

RSO2 SO42 -

RSO2OO -

RSO3- + 1/2 O2

Scheme 1. Oxidative pathways of sulfinates.

RSO2

M. FONTANA ET AL.

The consumption of oxygen by the peroxynitrite-dependent oxidation of sulfinates could result from the known reaction of sulfonyl radicals with oxygen with production of sulfonyl peroxyl radical (RSO2OO•) (Sevilla et al., 1990). The sulfonyl peroxyl radical is a highly reactive intermediate (Sevilla et al., 1990) and its possible reaction with excess sulfinate can proceed to give peroxysulfonate (RSO2OO–). The peroxysulfonate formed would decompose to give sulfonate and molecular oxygen. It should be noted that sulfonyl radicals, as shown in the scheme, may initiate an oxygen-dependent radical chain propagation step that could be responsible of amplification of the oxidation. Other possible reactions previously suggested for sulfonyl radical (Fellman et al., 1987; Green and Fellman, 1994) include its dimerization to form the corresponding disulfone (RSO2–SO2R) and its condensation with the sulfonyl peroxyl radical intermediate leading to the persulfonate (RSO2–OO–SO2R). Subsequent hydrolysis of the disulfone or of the persulfonate could represent additional routes for the production of sulfonates: RSO2–

RSO3–

+ 2H+

(3)

RSO2–OO–SO2R + H2O ĺ 2 RSO3– + ½ O2 + 2H+

(4)

RSO2–SO2R

H2O ĺ

However, the production of sulfonates through the intermediate formation of disulfone do not require oxygen, in contrast with the observed oxygen consumption associated with the oxidative reaction. In conclusion, the above results indicate that peroxynitrite and its derived species can be included into the non-specific biological oxidant able to accomplish the oxidation of the sulfinic group of hypotaurine and cysteine sulfinic acid to the sulfonic of taurine and cysteic acid, respectively. However, the formation of intermediate sulfonyl radicals, which can propagate oxidative reactions, raises the question about the metabolic fate and/or the pathophysiological significance of these species. Among sulfur-centered radicals, it has been already shown that thiyl radicals (RS•), generated by one-electron oxidation of thiols, react with molecular oxygen to form thiyl peroxyl radical (RSOO•) which can rearrange to sulfonyl radical (RSO2•) that further react with oxygen to generate the sulfonyl peroxyl radical (RSO2OO•) (Sevilla et al., 1990). Both thiyl and thiyl-derived radicals such as sulfonyl radical are potent initiators of lipid peroxidation (Schöneich et al., 1992), thus behaving as oxidants, which can exert damaging effects in vivo. However, the biological relevance of RS•-derived radicals remains a matter of debate and recently an additional group of redox active molecules termed reactive sulfur species (RSS) has been proposed to be formed in vivo under conditions of oxidative stress (Giles et al., 2001). Although sulfur-containing molecules are generally considered to act as antioxidants and, in particular, our previous studies showed that hypotaurine and cysteine sulfinic acid have the ability to inhibit peroxynitrite-dependent reactions (Fontana et al., 2004), the transient formation of sulfur reactive species during the oxidative reaction, could have a physiological importance which remain to be investigated.

REACTIVITY OF HYPOTAURINE WITH PEROXYNITRITE

5. REFERENCES Alvarez, J. G. and Storey, B. T., 1983, Taurine, hypotaurine, epinephrine and albumin inhibit lipid peroxidation in rabbit spermatozoa and protect against loss of motility, Biol. Reprod. 29:548. Aruoma, O. I., Halliwell, B., Hoey, B. M., and Butler, J., 1988, The antioxidant action of taurine, hypotaurine and their metabolic precursor, Biochem. J. 256:251. Augusto, O., Bonini, M. G., Amanso, A. M., Linares, E., Santos, C. C. X., and De Menezes, S. L., 2002, Nitrogen dioxide and carbonate radical anion: two emerging radicals in biology, Free Radic. Biol. Med. 32:841. Beckman, J. S., Chen, J., Ischiropoulos, H., and Crow, J. P., 1994, Oxidative chemistry of peroxynitrite, Methods Enzymol. 233:229. Eiserich, J. P., Patel, R. P., and O’Donnel, V. B., 1998, Pathophysiology of nitric oxide and related species: free radical reactions and modification of biomolecules, Mol. Aspects Med. 19:221. Fellman, J. H., Green, T. R., and Eicher, A. L., 1987, The oxidation of hypotaurine to taurine: bis-aminoethyl-Įdisulfone, a metabolic intermediate in mammalian tissue, Adv. Exp. Med. Biol. 217:39. Fontana, M., Pecci, L., Duprè, S., and Cavallini, D., 2004, Antioxidant properties of sulfinates: protective effect of hypotaurine on peroxynitrite-dependent damage, Neurochem. Res. 29:111. Fontana, M., Amendola, D., Orsini, E., Boffi, A., and Pecci, L., 2005, Oxidation of hypotaurine and cysteine sulphinic acid by peroxynitrite, Biochem. J. 389:233. Giles, G. I., Tasker, K. M., and Jacob, C., 2001, Hypothesis: the role of reactive sulfur species in oxidative stress, Free Radic. Biol. Med. 31:1279. Green, T. R., Fellman, J. H., and Eicher, A. L., 1985, Myeloperoxidase oxidation of sulfur-centered and benzoic acid hydroxyl radical scavengers, FEBS Lett. 192:33. Green, T. R., Fellman, J. H., Eicher, A. L., and Pratt, K. L., 1991, Antioxidant role and subcellular location of hypotaurine and taurine in human neutrophils, Biochim. Biophys. Acta 1073:91. Green, T. R. and Fellman, J. H., 1994, Effect of photolytically generated riboflavin radicals and oxygen on hypotaurine antioxidant free radical scavenging activity, Adv. Exp. Med. Biol. 359:19. Harman, L. S., Mottley, C., and Mason, R. P., 1984, Free radical metabolites of L-cysteine oxidation, J. Biol. Chem. 259:5609. Hirschberger, L. L., De la Rosa, J., and Stipanuk, M., 1985, Determination of cysteinesulfinate, hypotaurine and taurine in physiological samples by reversed-phase high-performance liquid chromatography, J. Chromatogr. B 343:303. Holmes, R. P., Goodman, H. O., Shihabi, Z. K., and Jarow, J. P., 1992, The taurine and hypotaurine content of human sem*n, J. Androl. 13:289. Huie, R. E. and Padmaja, S., 1993, The reaction of NO with superoxide, Free Rad. Res. Commun. 18:195. Huxtable, R. J., 1992, Physiological actions of taurine, Physiol. Rev. 72:101. Jourd’heuil, D., Jourd’heuil, F. L., and Feelisch, M., 2003, Oxidation and nitrosation of thiols at low micromolar exposure to nitric oxide. Evidence for a free radical mechanism, J. Biol. Chem. 278:15720. Karoui, H., Hogg, N., Fréjaville, C., Tordo, P., and Kalyanaraman, B., 1996 Characterization of sulfur-centered radical intermediates formed during the oxidation of thiols and sulfite by peroxynitrite. ESR-spin trapping and oxygen uptake studies, J. Biol. Chem. 271:6000. Kissner, R., and Koppenol, W. H., 2002, Product distribution of peroxynitrite decay as function of pH, temperature, and concentration, J. Am. Chem. Soc. 124:234. Koppenol, W. H., Moreno J. J., Pryor W. A., Ischiropoulos H., and Beckman, J. S., 1992, Peroxynitrite, a cloaked oxidant formed by nitric oxide and superoxide, Chem. Res. Toxicol. 5:834. Learn, D. B., Fried, V. A., and Thomas, E. L., 1990, Taurine and hypotaurine content of human leukocytes, J. Leukoc. Biol. 48:174. Mottley, C. and Mason, R. P., 1988, Sulfate anion radical formation by the peroxidation of (bi)sulfite and its reaction with hydroxyl radical scavengers, Arch. Biochem. Biophys. 267:681. Pasantes-Morales, H., Klethi, J., Ledig, M., and Mandel, P., 1972, Free amino acids of chicken and rat retina, Brain Res. 41:494. Pecci, L., Costa, M., Montefoschi, G., Antonucci, A., and Cavallini, D., 1999, Oxidation of hypotaurine to taurine with photochemically generated singlet oxygen: the effect of azide, Biochem. Biophys. Res. Commun. 254:661. Pryor, W. A. and Squadrito, G. L., 1995, The chemistry of peroxynitrite: a product from the reaction of nitric oxide with superoxide, Am. J. Physiol. 268:L699. Radi, R., Peluffo, G., Alvarez, M. N., Naviliat, M., and Cayota, A., 2001, Unraveling peroxynitrite formation in biological system, Free Radic. Biol. Med. 30:463. Ricci, G., Duprè, S., Federici, G., Spoto, G., Matarese, R. M., and Cavallini, D., 1978, Oxidation of hypotaurine to taurine by ultraviolet irradiation, Physiol. Chem. Phys. 10:435.

M. FONTANA ET AL.

Schöneich, C., Dillinger, U., von Bruchhausen, F., and Asmus, K.-D., 1992, Oxidation of polyunsaturated fatty acids and lipids through thiyl and sulfonyl radicals: reaction kinetics, and influence of oxygen and structure of thiyl radicals, Arch. Biochem. Biophys. 292:456. Sevilla, M. D., Becker, D., and Yan, M., 1990, The formation and structure of the sulfoxyl radicals RSO•, RSOO•, RSO2•, and RSO2OO• from the reaction of cysteine, glutathione and penicillamine thiyl radicals with molecular oxygen, Int. J. Radiat. Biol. 57:65. Stewart, V. C. and Heales, S. J., 2003, Nitric oxide-induced mitochondrial dysfunction: implications for neurodegeneration, Free Radic. Biol. Med. 34:287. Tadolini, B., Pintus, G., Pinna, G. G., Bennardini, F., and Franconi, F., 1995, Effects of taurine and hypotaurine on lipid peroxidation, Biochem. Biophys. Res. Commun. 213:820. Wright, C. E., Tallan, H. H., Lin, Y. Y., and Gaull, G. E., 1986, Taurine: biological update, Annu. Rev. Biochem. 55:427.

CYSTEAMINE DIOXYGENASE: EVIDENCE FOR THE PHYSIOLOGICAL CONVERSION OF CYSTEAMINE TO HYPOTAURINE IN RAT AND MOUSE TISSUES Relicardo M. Coloso, Lawrence L. Hirschberger, John E. Dominy, Jeong-In Lee, and Martha H. Stipanuk*

1. INTRODUCTION During the 1960s, Cavallini and coworkers demonstrated the presence of a protein with cysteamine dioxygenase activity in animal tissues and proposed that this enzyme was important in the conversion of cysteamine to hypotaurine (Cavallini et al.,1963, 1966). Based on the earlier demonstration that cysteamine was a component of coenzyme A (Baddiley et al., 1953; Novelli et al., 1954) as well as their own work, they proposed a coenzyme A-cysteamine pathway for taurine production. As shown in Fig. 1, coenzyme A is synthesized using cysteine, but the cysteinyl moiety is subsequently decarboxylated to produce the cysteamine moiety of coenzyme A. Coenzyme A turnover results in production of pantetheine, and pantetheine is hydrolyzed by pantetheinase to yield cysteamine and pantothenic acid. The released cysteamine is oxidized to hypotaurine and then further oxidized to taurine by an unknown mechanism. An alternative pathway of taurine synthesis from cysteine is also shown in Fig. 1. This pathway involves the oxidation of cysteine to cysteinesulfinate, the decarboxylation of cysteinesulfinate to hypotaurine, and the conversion of hypotaurine to taurine. After the association of low cysteinesulfinate decarboxylase activity, and subsequently of low cysteine dioxygenase activity, with a limited capacity of cats and certain other species to synthesize taurine (Knopf et al., 1978; Stipanuk et al., 1992, 1994) the focus of research in taurine biosynthesis moved away from the cysteamine pathway to the cysteinesulfinate pathway and remained there for several decades (Stipanuk et al., 1986, 2004). However, identification of a lack of panthothenate kinase (PANK2) as the basis for Hallervorden-Spatz syndrome (now known as neurodegeneration with brain iron accumulation or pantothenate-kinase associated neurodegeneration) (Zhou et al., 2001) and the discovery that Vanin-1 is a membranebound pantetheinase that cleaves pantetheine to cysteamine and pantothenic acid (Pitari *

Relicardo M. Coloso, Lawrence L. Hirschberger, John E. Dominy, Jeong-In Lee, Martha H. Stipanuk, Cornell University, Division of Nutritional Sciences, Ithaca, New York 148453, USA.

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

R. M. COLOSO ET AL.

et al., 2000) have renewed interest in cysteamine as a potentially significant intermediate in taurine biosynthesis. Pantothenate kinase is necessary for the synthesis of coenzyme A from cysteine, and pantetheinase is necessary for the release of the cysteamine moiety derived from cysteine during coenzyme A degradation. The high cysteine concentration in some regions of the brain of PANK2-deficient patients (Perry et al., 1985) suggests that coenzyme A synthesis may play a quantitatively important role in cysteine removal in some tissues. However, no direct measurements of cysteine utilization for coenzyme A synthesis or of coenzyme A turnover on a whole body level have been reported and little information is available for particular tissues or cell types. Perfusion of rat heart with 7 µM pantothenic acid and 10 µM [35S]cysteine (and mercaptodextran to help maintain cysteine in the thiol form) resulted in 1.6-times as much radioactivity being incorporated into coenzyme A and coenzyme A intermediates (e.g., 4’-phosphopantetheine, dephosphocoenzyme A) as into protein (Chua et al., 1984).

Cysteine

Cysteine dioxygenase

CO2 O2

Cysteinesulfinate

Coenzyme A Phosphopantetheine Pantetheine

CO2

Pantetheinase

H2O Pantothenic acid

Cysteamine O2 Cysteamine

dioxygenase

Hypotaurine ½ O2

Taurine Figure 1. Alternative pathways for taurine production.

Pantetheine is formed in the process of coenzyme A degradation (see Fig. 1). Pantetheinase activity has been found in many tissues from mammals but its biological role has never been explored in detail. The pig kidney enzyme was purified and biochemically characterized in the 1970s by Duprè and Cavallini (1979). The mouse Vanin-1 was initially characterized as a membrane molecule expressed by a subset of thymic stromal cells that was involved in the homing of bone marrow precursor cells into the thymus (Aurrand-Lions et al., 1996). Then, partial sequences of the pig pantetheinase were reported (Maras et al., 1999), and on the basis of sequence similarities, the identity between pantetheinase and mouse Vanin-1 was postulated (Pitari et al., 2000). Pitari et al. (2000) went on to demonstrate that the Vanin-1 gene encodes a pantetheinase that is widely expressed in mouse tissues. They showed that pantetheinase activity is

CYSTEAMINE DIOXYGENASE

specifically expressed by Vanin-1 transfected cells and is immuno-depleted by specific antibodies; that Vanin-1 is a GPI-anchored pantetheinase (an ectoenzyme); and that Vanin-1 null mice are deficient in membrane-bound pantetheinase activity in kidney and liver. Furthermore, they showed that a major consequence of disruption of the Vanin-1 gene in mice is that liver and kidney of these mice were depleted of detectable free cysteamine; cysteamine levels in liver and kidney of wild-type mice were 24 and 15 nmol/g, respectively. Thus, the membrane-bound pantetheinase appears to be the major source of cysteamine in tissues under physiological conditions. Evidence for a quantitatively significant rate of coenzyme A synthesis in brain and heart and for significant cysteamine production during coenzyme A degradation in liver or kidney indicate the need to further consider the relative importance of dietary cysteine as a precursor for coenzyme A synthesis and also the relative importance of cysteamine as a precursor for taurine biosynthesis. This paper summarizes several approaches which our laboratory has taken recently in an effort to further explore the role of cysteamine in taurine biosynthesis.

2. MATERIALS AND METHODS 2.1. Measurement of Cysteamine Dioxygenase in Rat and Mice Tissues Tissues were obtained from adult mice (C57/B6) or rats (Sprague-Dawley). Mice were anesthetized with CO2 and rats were anesthetized with pentobarbital prior to tissue collection. The liver, kidney and brain were removed immediately, frozen in liquid nitrogen and stored at -80oC until used. Minced liver, kidney or brain was hom*ogenized in 2.5 volumes of 0.01 M potassium phosphate buffer, pH 7.6. The hom*ogenate was sonicated by four 15 s bursts (15 s cooling period between bursts) and centrifuged at 1800xg for 10 min at 4oC; the supernatant was used for the enzyme assay. The assay procedure for cysteamine dioxygenase was modified from the original method used by Cavallini et al. (1966). A 250-µl aliquot of supernatant prepared as previously described was pipetted into an Eppendorf tube containing 25 µl of 1 M potassium phosphate buffer, pH 7.6, 250 µl of 10 mM cysteamine, 50 µl of 50 mM sodium sulfide, and 175 µl of deionized water. The final cysteamine concentration in the assay mixture was 3.3 mM. The tube was then placed into a Thermomixer (Eppendorf AG, Hamburg, Germany) at 37oC. Incubations were terminated at 1 h by the addition of 250 µl of 5% (w/v) sulfosalicylic acid. Zero-time incubations served as blanks. The mixture was then centrifuged at 10,620xg in an Eppendorf centrifuge 5810 R (Eppendorf, AG, Hamburg, Germany) for 10 min at 4oC. The acid supernatant was decanted into a clean tube and stored at -20oC until hypotaurine and taurine were measured. Enzyme activity was expressed either as µmol hypotaurine produced per h per g wet wt of tissue or as nmol hypotaurine produced per h per mg of protein.

2.2. Assay of Tissue Protein Content Total protein in tissue hom*ogenates was assayed by the bicinchoninic acid method of Smith et al. (1985) using bovine serum albumin as a standard. The total protein was used

R. M. COLOSO ET AL.

as a basis for expression enzyme activity. 2.3. Dietary Study Male Sprague-Dawley rats were randomly assigned to groups of 3. Each group of 3 rats was housed together in one cage in a room that was dark from 06:00 to 18:00 h. Food was placed in the cage at the beginning of the dark period and removed at the end of the dark period each day to accustomize rats to beginning to eat at the beginning of the dark period. Rats were initially given a high protein diet (400 g casein/kg diet) for 7 days. At the beginning of the dark period on the experimental day, rats were given a new diet: low protein (100 g casein/kg diet); low protein + cysteamine (100 g casein + 7.2 g cysteamine/kg diet); or low protein + cysteine (100 g casein + 8.1 g cysteine/kg diet). Diets were prepared by mixing 100 g of diet with 100 ml of hot 3% (w/v) agar solution. One group of rats on each diet was killed at 12:00 h (6 hours after introduction of the new diet), and one group of rats on each diet was killed at 16:00 h (10 hours after introduction of the new diet). Rats were anesthetized with sodium pentobarbital, and blood was obtained both from the portal vein and from the heart with heparinized syringes. Blood was immediately centrifuged, and plasma was collected and frozen. Liver, kidneys and brain were removed and immediately frozen in liquid nitrogen for subsequent measurement of cysteamine, hypotaurine and taurine levels and for assay of cysteamine dioxygenase activity. 2.4. Measurement of Cysteamine, Hypotaurine and Taurine by High Performance Liquid Chromatography 2.4.1. Standards and Sample Preparation Stock standard solutions of cysteamine, hypotaurine, and taurine (Sigma Chemical Co., St.Louis, MO) were prepared in deionized water and stored at -20oC until used. Liver, brain, kidney and plasma samples were obtained from mice and rats as described below and stored at -80oC until used. Frozen tissues from Vanin 1 -/- and +/+ mice were obtained from Dr. Franck Galland (Centre d’Immunologie de Marseille-Luminy, INSERM-CNRS-Universite de la Mediterranee, France). Frozen tissues were hom*ogenized in ice-cold 5% (w/v) sulfosalicylic acid to prepare 20% (w/v) hom*ogenates. hom*ogenates were then centrifuged at 10,000xg for 10 min to obtain the acid supernatants. One volume of plasma was mixed with four volumes of 5% sulfosalicylic acid. Acid supernatants from cysteamine dioxygenase assay mixtures were prepared as described above. 2.4.2. Sample Derivatization and HPLC Measurement of Cysteamine, Hypotaurine and Taurine To 0.5 ml of acid supernatant was added 50 µl of m-cresol purple (0.2 mM) with mixing. While mixing the sample in a vortex mixer, 0.48 ml of 2 M KOH/ 2.4 M KHCO3 was added, followed by the addition of 50 µl of 50 mM dithiothreitol (DTT). The mixture was incubated at 37oC for 30 min. After incubation, 50 µl of 200 mM iodoacetate was added with mixing, and the mixture was allowed to stand in the dark for 10 min to alkylate the thiol groups.

CYSTEAMINE DIOXYGENASE

Chromatography of derivatized samples was carried out on a 4.6 x 150 mm column packed with Nova-Pak C18 packing materials (4 µm spherical particles) (Waters Corp., Milford, MA) equipped with a guard C18 cartridge (5 µm spherical particles) (Alltech Associates, Inc., Deerfield, IL). Under conditions of no-flow, 75 µl of o-phthalaldehyde (OPA)-2-mercaptoethanol derivatizing reagent and then a 50 µl volume of the sample acid supernatant or standard solution were injected into the pre-column tubing by an automatic sample injector (WISP Model 712, Waters Corp., Milford, MA). The derivatizing reagent was prepared fresh daily by mixing 3.5 mg OPA with 50 µl 95% (v/v) ethanol, 5 ml 100 mM borate buffer (pH 10.4), and 10 µl of 2-mercaptoethanol. A 3-minute delay was programmed prior to initiating flow of mobile phase to allow reaction of amines with OPA. A gradient mobile phase was used. Buffer A was 100 mM potassium phosphate buffer-3% (v/v) tetrahydrofuran (THF), pH 7.0, and buffer B was 100 mM potassium phosphate buffer-3% THF-40% (v/v) acetonitrile, pH 7.0. The buffers were filtered through a 0.45 µm filter (Micron Separations, Inc., Westboro, MA) before use. The flow rate of the mobile phase was 1.0 ml/min. The column was at room temperature. The mobile phase was started isocratically for the first 1.0 min at 3% buffer B, increased to 30% buffer B over 6 min, to 55% buffer B over 13 min, and then to 100% buffer B over 2 min. At 22 min into the run, the mobile phase was decreased to 3% buffer B over 10 min and the column was allowed to equilibrate for another 11 min before the next sample was injected. Detection of amino acids was done using a Spectra/glo Filter Fluorometer (Gilson Medical Electronics, Middleton, WI) equipped with a 5 µl flow cell and filters for excitation and emission peaks at 360 and 455 nm, respectively. The fluorometer was connected to a personal computer equipped with Peak Simple Chromatography Data System version 3.21 (LabAlliance, State College, PA) for integration of chromatographic peaks.

3. RESULTS 3.1. Measurement of Cysteamine, Hypotaurine and Taurine The HPLC procedure allowed measurement of cysteamine, hypotaurine and taurine in the same run. It was necessary to block the sulfhydryl group of cysteamine prior to OPA derivatization. A sample chromatogram for standards is shown in Fig. 2. This method was very sensitive, allowing detection of picomolar amounts of cysteamine and hypotaurine.

R. M. COLOSO ET AL.

Figure 2. Chromatogram of HPLC separation of mixture of standards: 100 µM each of glutathione (GSH), cysteine (CYS), hypotaurine (HTAU) and taurine (TAU) and 250 µM of cysteamine (CSN). SSA = sulfosalicylic acid.

3.2. Cysteamine Dioxygenase Activity in Rat and Mouse Tissues The rate of conversion of cysteamine to hypotaurine + taurine was assayed in mouse and rat tissues using assay conditions based on those reported by Cavallini et al. (1966). The assay system contained 3.3 mM cysteamine and was buffered at pH 7.6. Although sulfide was included in the assays used by Cavallini et al. (1966), we found no effect of sulfide addition on the rate of conversion of cysteamine to hypotaurine. Hypotaurine and taurine were measured by HPLC; no increases in taurine were observed so activity was calculated solely based on the increase in hypotaurine concentration. Activity in mouse liver was 91 nmol hypotaurine produced per min per g tissue; activity in mouse kidney was 37 nmol hypotaurine produced per min per g tissue. Activity was lower in rat tissues: 26 nmol hypotaurine per min per g tissue for liver and 21 nmol hypotaurine per min per g tissue for kidney.

3.3. Short-Term Exposure to High Protein or High Cysteamine Does Not Affect Tissue Cysteamine Dioxygenase Activity in Rat Tissues Rats switched from a high protein diet to a low protein diet or to a low protein diet supplemented with cysteamine did not demonstrate a change in tissue cysteamine dioxygenase activity over the course of 10 h. Hepatic activities are reported in Table 1. The activity of cysteamine dioxygenase in kidney averaged 3.5 ± 0.4, and that in brain was 3.7 ± 0.5 nmol hypotaurine per h per mg protein. Renal and brain enzyme activity was not affected by short-term exposure to the low protein or the cysteaminesupplemented diet. The possible effect of a long-term change of diet was not investigated.

CYSTEAMINE DIOXYGENASE

Table 1. Cysteamine dioxygenase activity in liver of rats fed various diets

Diet

Cysteamine dioxygenase activity nmol hypotaurine per h per mg protein 6h 10 h

Low Protein Low Protein + Cysteamine High Protein

4.5 ± 0.3 4.3 ± 0.3 4.4 ± 0.7

3.9 ± 0.2 4.1 ± 0.4 3.7 ± 0.4

Values are means ± SD for 3 rats.

n m o l/g tis s u e o r µ m o l/L p la s m a

500 400

H y p o t a u r in e

300 200

100

300

C y s t e a m in e

200

100

* *

* * - +

- +

Liver

Kidney

- + Brain

* - + Plasma Heart

* - +

- +

Plasma Portal

Liver

Kidney

Brain

- +

Plasma Heart

Plasma Portal

10h

Figure 3. Hypotaurine and cysteamine levels in tissues and plasma of rats fed either a low protein diet (100 g casein/kg diet) or a cysteamine-supplemented low protein diet (100 g casein + 7.2 g cysteamine/kg diet) for 6 or 10 hours. Prior to introduction of the experimental diet, rats were adapted to a high-protein diet with food available only during the dark period. Following the normal 12-h fasting/light period, rats were given either the low protein or low protein + cysteamine diet and then killed 6 or 10 hours later. An asterisk (*) indicates that the value for the cysteamine-supplemented group (+) is significantly different than that for the low-protein fed group (-) at P < 0.05 by ANOVA and Tukey’s procedure. Values are means ± SD for 3 rats.

R. M. COLOSO ET AL.

nmol/g tissue or µmol/L plasma

Taurine

12000

6 h

10 h

10000

8000 6000 4000 2000 - + L iv e r

- +

K id n e y B r a in

- +

P la s m a P la s m a P o rta l H e a rt

- + L iv e r

- +

K id n e y B r a in

- +

P la s m a P la s m a P o rta l H e a rt

Figure 4. Taurine level in tissues and plasma of rats fed either a low protein diet (100 g casein/kg diet) or a cysteamine-supplemented low protein diet (100 g casein + 7.2 g cysteamine/kg diet) for 6 or 10 hours. An asterisk (*) indicates that the value for the cysteamine-supplemented group (+) is significantly different than that for the low-protein fed group (-) at P < 0.05 by ANOVA and Tukey’s procedure. Values are means ± SD for 3 rats.

3.4. Rats Fed Cysteamine Have Elevated Levels of Hypotaurine and Taurine in Tissues Rats that had been adapted to a high protein diet (400 g casein/kg diet), with food available only during the dark cycle, were introduced to diets that contained 100 g casein with or without 7.2 g cysteamine per kg diet at the beginning of the dark cycle and then killed after 6 or 10 hours. Cysteamine and hypotaurine levels in these rats are shown in Fig. 3. Cysteamine levels in plasma, liver, kidney and brain of rats fed the cysteaminesupplemented diet were significantly and substantially higher than those in tissues of rats fed the basal diet. Rats fed the cysteamine-supplemented diet had markedly elevated levels of hypotaurine in liver, kidney and brain, but not in plasma. Taurine levels were also substantially elevated in liver of rats at 6 hours and in kidney of rats at both 6 and 10 hours, as shown in Fig. 4. For comparison, we looked at the hypotaurine level in tissues of rats fed an equimolar amount of supplemental cysteine. As shown in Fig. 5, tissue and plasma hypotaurine levels were higher in rats fed a diet supplemented with cysteine than in those fed a diet supplemented with an equimolar amount of cysteamine. This is consistent with cysteine being more readily converted to hypotaurine as a result of cysteine dioxygenase and cysteinesulfinate decarboxylase activities. Nevertheless, the increase in hypotaurine level in liver and kidney of rats given supplemental cysteamine was 42% and 52% as much (at 6 hours), respectively, of that observed in rats given an equimolar amount of supplemental cysteine, demonstrating that cysteamine is a good precursor of hypotaurine in vivo. Supplementation of the diet with cysteine had no effect on tissue cysteamine concentrations, and supplementation of the diet with cysteamine had no effect on tissue cysteine concentrations.

CYSTEAMINE DIOXYGENASE

n m o l/g tis s u e

H y p o ta u r in e L e v e l

Basal + C y s te a m in e

800

+ C y s te in e

600

400

200

L iv e r

K id n e y

Figure 5. Hypotaurine level in liver and kidney of rats fed a low protein diet (100 g casein/kg diet), a cysteamine-supplemented low protein diet (100 g casein + 7.2 g cysteamine/kg diet) or a cysteine-supplemented low protein diet (100 g casein + 8.1 g cysteine/kg diet) for 6 hours. An asterisk (*) indicates that the value for the cysteamine- or cysteine-supplemented group (+) is significantly different than that for the low-protein fed group (-) at P < 0.05 by ANOVA and Tukey’s procedure. Values are means ± SD for 3 rats.

3.5. Hypotaurine Is Not Elevated in Tissues of Vanin-1 Knockout Mice Pitari et al. (2000) reported that cysteamine levels were 15 nmol/g [~75 pmol/mg protein] for kidney and 24 nmol/g [~120 pmol/mg protein] for liver of wild-type mice but undetectable in tissues of Vanin-1 knockout mice. Based on the reported lack of membrane-bound pantetheinase activity in the Vanin-1 knockout mouse that resulted in very low cysteamine levels in knockout mice compared to their wild-type littermates, we hypothesized that Vanin-1 knockout mice would also have lower hypotaurine levels than wild-type mice. However, we did not observe lower hypotaurine levels in Vanin-1 (-/-) mice. Hypotaurine was not detected in liver or brain of either Vanin-1 (+/+) or Vanin-1 (-/-) mice that had been fed a non-purified rodent diet. Hypotaurine was measurable in kidney, but levels were significantly higher, rather than lower, in kidneys of the knockout mice compared to wild-type mice. It is also worth noting that we did not observe large differences in tissue cysteamine and glutathione (GSH) levels as compared to the much lower cysteamine and higher GSH levels that have been reported by other investigators for the Vanin-1 knockout mouse (Pitari et al., 2000; Berruyer et al., 2004).

R. M. COLOSO ET AL.

Table 2. Glutathione, cysteine, taurine, hypotaurine and cysteamine levels in liver, kidney and brain of Vanin-1 -/- and Vanin-1 +/+ mice Wild-type mice

LIVER GSH (total, after reduction) Cysteine (total, after reduction) Taurine Hypotaurine Cysteamine KIDNEY GSH (total, after reduction) Cysteine (total, after reduction) Taurine Hypotaurine Cysteamine BRAIN GSH (total, after reduction) Cysteine (total, after reduction) Taurine Hypotaurine Cysteamine

Vanin-1 knockout mice

µmoles per g tissue 7.5 ± 0.3 0.088 ± 0.004 1.9 ± 0.5 ND 0.16 ± 0.01

6.8 ± 1.1 0.088 ± 0.007 2.5 ± 1.0 ND 0.09 ± 0.08

2.6 + 0.9 0.75 + 0.25 2.2 + 0.3 0.06 + 0.01 0.35 ± 0.14

2.6 + 0.3 0.58 + 0.05 2.4 + 0.4 0.13 + 0.01* 0.23 ± 0.02

2.0 ± 0.2 0.13 ± 0.01 3.0 ± 0.1 ND 0.11 ± 0.10

2.0 ± 0.2 0.09 ± 0.02 2.7 ± 0.3 ND ND

*Significantly different from wild-type value at P < 0.05. ND = not detected.

4. DISCUSSION These results collectively support a role of the coenzyme A Æ cysteamine Æ hypotaurine metabolic pathway in mammalian tissues. Significant cysteamine dioxygenase activity was observed in rat and mouse tissues, particularly if considered in light of the relatively low levels of cysteine dioxygenase activity present in tissues of animals fed low protein diets (Stipanuk et al., 2002). However, the cysteamine dioxygenase activities we report here are substantially lower than those reported by Cavallini and coworkers (Duprè and DeMarco, 1964; Federici et al., 1980). This may be due to improved methodology resulting in more accurate and precise measurements of hypotaurine production. The earlier assays made use of radiolabeled cysteamine as substrate and involved quantitation of radiolabeled product by paper chromatography or measurement oxygen consumption (Duprè and DeMarco, 1964; Federici et al., 1980).

CYSTEAMINE DIOXYGENASE

Hypotaurine was detected in tissues of rats during the 10-h period of low protein-diet consumption. Hypotaurine averaged 35 nmol/g in the liver, 95 nmol/g in the kidney, 25 nmol/g in the brain, and 1 µmol/l in arterial plasma. These levels were higher in rats given the diet containing cysteamine: 360 nmol/g in liver, 340 nmol/g in kidney, 60 nmol/g in brain, and 4 µmol/l in arterial plasma. Even higher levels of hypotaurine were observed in tissues of rats fed a diet containing excess cysteine. Assessment of tissue hypotaurine levels in rats fed cysteamine vs cysteine in the diet clearly indicates that cysteamine can be converted to hypotaurine at a physiologically significant rate. Depending upon the rate of cysteamine production via coenzyme A turnover, cysteamine could be a quantitatively important precursor of taurine. The levels of hypotaurine reported herein are consistent with several other recent reports of hypotaurine levels in tissues of rats fed diets with varying sulfur amino acid content. Kasai et al. (1992) fed rats a diet with 80 g casein/kg (vs. 100 g/kg in our low protein diet) without or with 30 g methionine/kg (vs. 7.2 g cysteamine or 8.1 g cysteine/kg in our supplemented treatment diets). They reported hypotaurine levels of 100 nmol/g in muscle, 440 nmol/g in kidney, and 200 nmol/g in spleen of rats fed the low casein diet. These levels are higher than those we observed in rats fed a slightly higher amount of casein in the diet; this may relate to net tissue breakdown in the rats fed the diet with only 80 g casein/kg as these animals were not growing. Hypotaurine levels were increased to 1030 nmol/g in muscle, 1400 nmol/g in kidney, and 800 nmol/g in spleen of rats fed the diet with excess methionine for 7 or 14 days. Hypotaurine is likely excreted in the urine, along with taurine, under conditions of very high sulfur amino acid intake, based on excretion of hypotaurine by rats given hypotaurine by intraperitoneal injection (Fujiwara et al., 1995). Although taurine levels consistently increase by a greater absolute amount than do hypotaurine levels, it is nevertheless evident that the capacity for oxidation of hypotaurine to taurine is exceeded at high rates of hypotaurine production, resulting in the accumulation of hypotaurine in tissues. The Vanin-1 knockout mouse initially appeared to be a useful model for the study of coenzyme A turnover because of the reported lack of pantetheinase and accumulation of cysteamine. Our observations, however, suggest that the block in pantetheine hydrolysis is not complete in the Vanin-1 knockout model. It is known that mice express at least two Vanin genes, Vanin-1 and Vanin-3 (Martin et al., 2001), so it is possible that other pantetheinases compensate for the lack of Vanin-1. Our data also indicate that tissue GSH levels are similar in Vanin-1 knockout and wild-type mice, indicating that it is very unlikely that changes in GSH levels, as has been suggested, are responsible for the increased resistance to oxidative injury that has been observed in Vanin-1 knockout mice (Berruyer et al., 2004).

5. ACKNOWLEDGMENTS This research was supported by a grant from the National Institutes of Health, grant PHS DK056649 awarded to MHS. JED was supported by a graduate student fellowship from the National Science Foundation.

R. M. COLOSO ET AL.

6. REFERENCES Aurrand-Lions, M., Galland, F., Bazin, H., Zakharyev, V. M., Imhof , B. A., and Naquet, P., 1996, Vanin-1, a novel GPI-linked perivascular molecule involved in thymus homing, Immunity 5:391-405. Baddiley, J., Thain, E. M., Novelli, G. D., and Lipmann, F., 1953, Structure of coenzyme A, Nature 17:76. Berruyer, C., Martin, F. M., Castellano, R., Macone, A, Malergue, F., Garrido-Urbani, S., Millet, V., Imbert, J., Duprè, S., Pitari, G., Naquet, P., and Galland, F., 2004, Vanin-1-/- mice exhibit a glutathione-mediated tissue resistance to oxidative stress, Mol. Cell. Biol. 24:7214-7224. Cavallini, D., De Marco, C., Scandurra, R., Duprè, S., and Graziani, M. T., 1966, The enzymatic oxidation of cysteamine to hypotaurine: purification and properties of the enzyme, J. Biol. Chem. 241:3189-3196. Cavallini, D., Scandurra, R., and De Marco, C., 1963, The enzymatic oxidation of cysteamine to hypotaurine in the presence of sulfide, J. Biol. Chem. 238:2999-3005. Chua, B. H., Giger, K. E., Kleinhans, B. J., Robishaw, J. D., and Morgan, H. E., 1984, Differential effects of cysteine on protein and coenzyme A synthesis in rat heart, Am. J. Physiol. 247:C99-C106. Duprè, S. and Cavallini, D., 1979, Purification and properties of pantetheinase from horse kidney, Methods Enzymol. 62:262-267. Duprè, S. and De Marco, C., 1964, Activity of some animal tissues on the oxidation of cysteamine to hypotaurine in the presence of sulphide, Ital. J. Biochem. 13:386-390. Federici, G., Ricci, G., Santoto, L., Antonucci, A., and Cavallini, D., 1980, in: Natural Sulfur Compounds: Novel Biochemical and Cultural Aspects, D. Cavallini, G. E. Gaull, and V. Zappia, eds., Plenum Press, New York, pp. 187-193. Fujiwara, M., Ubuka, T., Abe, T., Yukihiro, K., and Tomozawa, M., 1995, Increased excretion of taurine, hypotaurine and sulfate after hypotaurine loading and capacity of hypotaurine metabolism in rats, Physiol. Chem. Phys. Med. NMR 27:131-137. Kasai, T., Ogo, Y., Otobe, Y., and Kiriyama, S., 1992, Accumulation of hypotaurine in tissues and urine of rats fed an excess methionine diet, J. Nutr. Sci. Vitaminol. (Tokyo) 38:93-101. Knopf, K., Sturman, J. A., Armstrong, M., and Hayes, K. C., 1978, Taurine: an essential nutrient for the cat, J. Nutr. 108:773-778. Maras, B., Barra, D., Duprè, S., and Pitari, G., 1999, Is pantetheinase the actual identity of mouse and human vanin-1 proteins? FEBS Lett. 461:149-152. Martin, F., Malergue, F., Pitari, G., Philippe, J. M., Philips, S., Chabret, C., Granjeaud, S., Mattei, M. G., Mungall, A. J., Naquet, P., and Galland, F., 2001, Vanin genes are clustered (human 6q22-24 and mouse 10A2B1) and encode isoforms of pantetheinase ectoenzymes, Immunogenetics 53:296-306. Novelli, G. C., Schmetz, F. J., Jr., and Kaplan, N. O., 1954, Enzymatic degradation and resynthesis of coenzyme A, J. Biol. Chem. 206:533-545. Perry, T. L., Norman, M. G., Yong, V. W., Whiting, S., Crichton, J. U., Hansen, S., and Kish, S. J., 1985, Hallervorden-Spatz disease: cysteine accumulation and cysteine dioxygenase deficiency in the globus pallidus, Ann. Neurol. 18:482-489. Pitari, G., Malergue, F., Martin, F., Philippe, J. M., Massucci, M. T., Chabret, C., Maras, B., Duprè, S., Naquet, P., and Galland, F., 2000, Pantetheinase activity of membrane-bound Vanin-1: lack of free cysteamine in tissues of Vanin-1 deficient mice, FEBS Lett. 483:149-154. Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K.,Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C., 1985, Measurement of protein using bicinchoninic acid, Anal. Biochem. 150:76-85. Stipanuk, M. H., 1986, Metabolism of sulfur-containing amino acids, Annu. Rev. Nutr. 6:179-209. Stipanuk, M. H., 2004, Sulfur amino acid metabolism: pathways for production and removal of hom*ocysteine and cysteine, Annu. Rev. Nutr. 24:539-577. Stipanuk, M. H., Bagley, P. J., Coloso, R. M., and Banks, M. F., 1992, Metabolism of cysteine to taurine by rat hepatocytes, Adv. Exp. Med. Biol. 315:413-421. Stipanuk, M. H., Bagley, P. J., Hou, Y. C., Bella, D. L., Banks, M. F., and Hirschberger, L. L., 1994, Hepatic regulation of cysteine utilization for taurine synthesis, Adv. Exp. Med. Biol. 359:79-89. Stipanuk, M. H., Londono, M., Lee, J-I., Hu, M., and Yu, A. F., 2002, Enzymes and metabolites of cysteine metabolism in nonhepatic tissues of rats show little response to changes in dietary protein or sulfur amino acid levels, J. Nutr. 132:3369-3378. Zhou, B., Westaway, S. K., Levinson, B., Johnson, M. A., Gitschier, J., and Hayflick, S. J., 2001, A novel pantothenate kinase gene (PANK2) is defective in Hallervorden-Spatz syndrome, Nat. Genet. 28:345-349.

IN VIVO REGULATION OF CYSTEINE DIOXYGENASE VIA THE UBIQUITIN-26S PROTEASOME SYSTEM John E. Dominy, Jr., Lawrence L. Hirschberger, Relicardo M. Coloso, and Martha H. Stipanuk∗

1. INTRODUCTION The intracellular free amino acid pool of cysteine is tightly regulated in the mammalian liver. In rats, for instance, intracellular cysteine is maintained between 20 and 100 µmol/g even when dietary protein or sulfur amino acid intake is varied from subrequirement to above-requirement levels for this species (Lee et al., 2004). The narrow range of permissible cysteine concentrations is the consequence of two homeostatic requirements. Liver tissue must keep cysteine levels sufficiently high to meet the needs of protein synthesis and the production of other essential molecules like glutathione, coenzyme A, taurine, and inorganic sulfur. At the same time, however, cysteine concentrations must also be kept below the threshold of cytotoxicity. An important enzyme that contributes to the regulation of steady-state intracellular cysteine levels is cysteine dioxygenase (CDO, EC 1.13.11.20). Expressed at high levels in the liver with lower levels in the kidney, brain, and lung, this Fe2+ metalloenzyme catalyzes the addition of molecular oxygen to the sulfhydryl group of cysteine, yielding cysteinesulfinate. The oxidative catabolism of cysteine to cysteinesulfinate represents an irreversible loss of cysteine from the free amino acid pool; cysteinesulfinate is shuttled into numerous metabolic pathways including hypotaurine/taurine synthesis, inorganic sulfur production, and use of the carbon backbone as pyruvate for gluconeogenesis or oxidative decarboxylation and cellular respiration. In vivo data suggest that the liver, the organ with the highest amount of CDO expression, uses CDO as a means of disposing excess cysteine obtained through the diet as well as to provide the essential metabolites sulfate, hypotaurine, and taurine (Garcia and Stipanuk, 1992). Steady-state levels of hepatic CDO protein are exquisitely regulated by dietary sulfur amino acids. Hepatic CDO activity is barely detectable in rats fed low-protein (i.e., ∗

John E. Dominy, Jr., Lawrence L. Hirschberger, Relicardo M. Coloso, Martha H. Stipanuk, Cornell University, Division of Nutritional Sciences, Ithaca, 14853 New York, USA.

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

J. E. DOMINY, JR., ET AL.

sulfur amino acid poor) diets, but increases as much as 35-fold in rats fed diets enriched with methionine, cystine, or total protein (Bella et al., 1999a,b). The regulation of CDO appears to be specifically associated with changes in intracellular cysteine concentration; other non-sulfur amino acids have no effect on CDO levels (Kwon et al., 2001). Cysteine’s ability to regulate CDO levels is rather unique in that it is an exclusively posttranslational phenomenon (Bella et al., 2000). As demonstrated in rat primary hepatocyte cultures, high levels of cysteine significantly prolong the half-life of CDO by decreasing its ubiquitination and subsequent degradation via the 26S proteasome system (Stipanuk et al., 2004). Because previous work describing the cysteine-dependent regulation of CDO by the ubiquitin-26S proteasome system has been limited to cell culture models, we decided to explore whether this same system is responsible for the regulation of hepatic and kidney CDO protein in vivo. We accomplished this by pharmacological inhibition of the 26S proteasome complex. We also evaluated whether this inhibition had any effect on hypotaurine/taurine metabolism as would be predicted by a perturbation in steady-state CDO levels.

2. MATERIALS AND METHODS 2.1. Animal Feeding Studies Male Sprague-Dawley rats (170-210 g) were purchased from Harlan Sprague Dawley (Indianapolis, IN). Rats were housed in polycarbonate cages containing paper bedding in a room maintained at 20°C and 60-70% humidity with light from 18:00 h to 06:00 h. These animals had ad libitum access to water but had access to food only during the dark cycle 06:00 h to 18:00 h, wherein food was provided in ceramic cups. To ensure high initial levels of hepatic CDO protein, all rats were fed a high protein diet (HP) for one week prior to the treatment day. This diet, prepared by Dyets, Inc. (Bethlehem, PA), contained 40% casein by weight. On the treatment day, rats were randomly assigned to the following experimental groups: maintenance on high protein (HP) diet, switch to a low protein (LP, 10% casein by weight) diet, switch to a low protein diet supplemented with 8.12 g/kg diet cysteine (LP+CYS), or switch to a low protein diet (LP+PII) plus an intraperitoneal injection of the specific proteasome inhibitor, proteasome inhibitor I (PII, 17 mg/kg in DMSO). The LP diet mix, made by Dyets, Inc., was prepared with 25 g/kg of sucrose excluded from it. For the LP and LP+PII diets, all of this sucrose was added back in. For the LP+CYS diet, 16.88 g/kg sucrose was added along with 8.12 g/kg cysteine to fully reconstitute the diet. All diets were prepared as gel cubes by the addition of a hot 3% (w/v) agar solution, followed by casting in containers at 4°C and cutting into easily managed cubes. At the end of the fasting light cycle on treatment day (time = 0 h), 3 rats were killed to establish baseline values and the remaining rats were switched to their assigned dietary treatments (6 rats/treatment). Animals were subsequently killed 6 h and 10 h after the diet switch (3 rats from each group per time point). Animals in the LP+PII group received an IP injection of PII 2.5 h after the diet switch. At the appropriate time point, rats were weighed, and anesthetized using sodium pentobarbital (30 mg/ml in 15% v/v ethanol) at a dose of 90 mg/kg. Ventricular blood was collected into heparinized (180 U/syringe) syringes by cardiac puncture, transferred to microfuge tubes, and centrifuged

IN VIVO REGULATION OF CDO BY THE 26S PROTEASOME SYSTEM

for 3 minutes at 3,000xg. The plasma was removed and frozen in liquid nitrogen. Whole livers and kidneys were removed, rinsed with ice-cold saline, and immediately frozen in liquid nitrogen. The experimental protocol used in this study was approved by the Cornell University Institutional Animal Care and Use Committee. 2.2. Western Blot Analysis Western blot analysis was conducted as previously described but with some minor modifications (Bella et al., 1999b). Briefly, livers were hom*ogenized in a lysis buffer (20% w/v) containing 50 mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, 0.5% v/v NP-40, 10 mM ortho-vanadate, 1x protease inhibitor co*cktail (Sigma, St. Louis, MO), 10 mM Nethylmaleimide, and 20 µM MG-132 (Boston Biochem, Boston, MA), pH=7.4. hom*ogenates were centrifuged at 16,500xg for 20 min. Supernatant proteins were separated by one-dimensional SDS-PAGE (either 12% or 15% w/v acrylamide) and then electroblotted overnight onto 0.45 µm Immobilin-P PVDF membranes (Millipore Corporation, Medford, MA). Immunoreactive protein was detected by chemiluminescence using rabbit anti-rat CDO polyclonal antibody (Stipanuk et al., 2004a) and HRPO-conjugated goat anti-rabbit secondary antibody (Supersignal Pico, Pierce) with exposure to Kodak X-OMAT film. Developed films were scanned using a desktop scanner. With the obtained electronic images, two-dimensional quantitative densitometric analysis was performed on areas of interest using AlphaEase software (Alpha Innotech, San Leandro, CA). The apparent molecular weights of native CDO (which runs as a double band on SDS-PAGE with a molecular weight of ~23 kDa) and ubiquitinated CDO (~23 kDa + n•8 kDa, where n = the number of attached ubiquitin moieties) were consistent with previously published values (Yamaguchi et al., 1978; Stipanuk et al., 2004b). 2.3. Analysis of Tissue Hypotaurine and Taurine Content by High Performance Liquid Chromatography (HPLC) Acid extracts of tissue hom*ogenates were prepared by hom*ogenizing frozen liver samples in 4 volumes of 5% (w/v) sulfosalicylic acid (SSA). hom*ogenates were then centrifuged at 10,000xg for 10 min. One-half milliliter of acid supernatant was removed and added to 50 µl of 0.2 mM m-cresol purple with mixing. While mixing the sample, 0.48 ml of 2 M KOH/2.4 M KHCO3 and subsequently 50 µl of 50 mM dithiothreitol were added. The mixture was incubated at 37°C for 30 min. After the incubation, 50 µl of 200 mM iodoacetate was added with mixing, and the mixture was placed in the dark for 10 min to alkylate free thiols. Chromatography of derivatized samples was conducted on a 4.6 x 150 mm column packed with Nova-Pak C18 4 µm spherical packing material (Waters Corp., Milford, MA) equipped with a C18 guard cartridge (5 µm spherical particles; Alltech Associates, Inc., Deerfield, IL). Samples and standards were derivatized with o-phthalaldehyde (OPA) prior to injection onto the column using an automatic sample injector (WISP Model 712, Waters Corp., Milford, MA). Under conditions of no-flow, 75 µl of OPA reagent was injected, and this was followed by injection of 50 µl of the standard or sample solution. The OPA reagent was made fresh each day by mixing 3.5 mg OPA with 50 µl 95% ethanol, 5 ml 100 mM borate buffer (pH = 10.4), and 10 µl 2-mercaptoethanol. A

J. E. DOMINY, JR., ET AL.

programmed 3-minute delay before the initiation of flow allowed sufficient time for amines to react with the OPA. Amino acids were separated by gradient elution using two buffers. Buffer A was 100 mM potassium phosphate buffer plus 3% (v/v) tetrahydrofuran (THF), pH=7.0, and buffer B was 100 mM potassium phosphate buffer plus 3% (v/v) tetrahydrofuran (THF) and 40% (v/v) acetonitrile, pH=7.0. Buffers were filtered through 0.45 µm filters before use. Flow rate was 1.0 ml/min and column temperatures were maintained at room temperature. Mobile phase was started isocratically for the first minute at 3% B and then gradients were run by increasing to 30% B over 6 min and to 55% buffer B over 13 min. The column was washed by increasing Buffer B to 100% over 2 min and holding at 100% B for 3 minutes. At 25 min into the run, the mobile phase was decreased to 3% B over 10 min and the column was allowed to equilibrate for another 11 min before the next sample injection. Detection of OPA-derivatized amino acids was done using a Spectra/glo Filter Fluorometer (Gilson Medical Electronics, Middleton, WI) equipped with a 5 µl flow cell and filters for excitation and emission peaks at 360 and 455 nm, respectively. The fluorometer was connected to a personal computer equipped with Peak Simple Chromatography Data System version 3.21 (LabAlliance, State College, PA) for the integration of chromatographic peaks. 2.4. Statistics All quantitative data are expressed as means ± standard deviations. Statistical analyses were conducted by ANOVA and Tukey’s post-test procedure using Prism 3 (GraphPad Software, Inc., San Diego, CA). Differences were considered significant at P≤0.05. Unless otherwise stated, fold changes are relative to 0 h values.

3. RESULTS Fig. 1 shows the effect of each treatment on the expression of hepatic CDO protein. Rats switched from the HP diet to the LP diet exhibited a significant decrease in CDO protein over the time course of the study; by the 10 h time point, CDO levels had fallen by more than 80%. CDO levels were stabilized, however, by maintaining animals on the HP diet, supplementing the LP diet with cysteine, or providing an injection of PII. Although the stabilization of CDO by PII was comparable to that of rats maintained on the HP diet or given the LP+CYS diet when measured at 6 h, the ability of PII to attenuate CDO degradation was diminished by approximately 50% between 6 and 10 h. Nevertheless, animals fed the LP diet and receiving a PII injection retained significantly more CDO protein than did animals fed the LP diet alone.

IN VIVO REGULATION OF CDO BY THE 26S PROTEASOME SYSTEM

Figure 1. The effects of dietary manipulation and proteasome inhibition on levels of liver CDO protein in rats. For SDS-PAGE analysis of CDO, 60 µg of soluble liver protein was loaded per lane on a 12% polyacrylamide gel. A representative Western is shown for one such analysis (Top). To determine the relative changes in protein levels for all samples, the optical density of each CDO band was measured by densitometry. Optical densities were then normalized by HP 0 h control values (run on each gel) and expressed as a percent of these controls in the bar graph (Bottom). HP, high protein diet; LP, low protein diet; LP+CYS, low protein diet + 8.12 g cysteine/kg diet; LP+PII, low protein diet + IP injection of proteasome inhibitor I (17 mg/kg). * P 3')

F R F R F R F R F

GTGGGGCGCCCCAGGCACCAGGGC CTCCTTAATGTCACGCACGATTTC GTGATTCTGAAAGTGGACTC GCTACTGCTACTAAGGATGG CCTGAACTGTGAGCTGATT GGAGTGTCTTGTGAAGTCAT ACAGAGTCTACTGGACATGG CCTGTCTTTGTACAGGATTC TAACTGTGATGTGGTAGCAG

GAGGTGAGAAGGAACATACA

PCR product Annealing (Я) (bp) 530

137

154

172

157

GPAT, glyceronephosphate O-acyltransferase; BCKADH, branched-chain keto acid dehydrogenase E1, beta polypeptide; BCAT2, branched chain aminotransferase 2, mitochondrial; PDHK, pyruvate dehydrogenase kinase, isoenzyme 4.

3. RESULTS 3.1. Changes in Hepatic Gene Expression Profile Involved in Metabolism Changes in the hepatic gene expression profile of HepG2 cells treated with taurine were assessed using cDNA microarray analyses. Of 8,298 genes on the GenePlorer TwinChip Human-8K microarray used in this study, 4,837 genes (59.2%) were identified as present in HepG2 cells. Of these genes, 477 genes underwent a greater than two-fold change in taurine-treated cells compared with the control cells. Among these, 128 genes were up-regulated and 349 were down-regulated more than two-fold by taurine treatment.

S-H. PARK ET AL.

122

Among 128 up-regulated and 349 down-regulated genes, known genes were counted as 87 and 206, respectively (Fig. 1). After clustering regulated genes based on biological function, we found that taurine up-regulated mainly genes that are implicated in the processes of amino acid metabolism, fatty acid metabolism, cytoskeletal activity, ion channel, signal transduction, cell proliferation and DNA repair. On the other hand, taurine downregulated mainly genes that are related to lipid metabolism, proteolysis, immune response, transcription, signal transduction, apoptosis and cell proliferation.

8,298 probes sets [GenePlorer TwinChip Human-8K microarray]

4,611“unknown” genes

3,559 “known” genes

4,837 genes expressed in HepG2 cells

128 gene H 2-fold up-regulated by taurine

87 “known” genes

41 “unknown” genes

128 quality control probe

3,333 genes not expressed in HepG2 cells

349 gene H 2-fold down-regulated by taurine

206 “known” genes

143 “unknown” genes

Figure 1. Diagrammatic representation of the analysis of genes tested in the current study.

Tables 2, 3 and 4 list the known taurine-responsive genes, whose major biological function is categorized into metabolism. Among taurine-responsive genes involved in carbohydrate metabolism, two genes were up-regulated more than four-fold and six genes were down-regulated more than two-fold (Table 2). For taurine responsive genes involved in lipid metabolism, glyceronephosphate O-acyltransferase and myotubularin related protein 4 genes were up-regulated 3.1- and 2.2-fold, respectively and six genes were downregulated more than two-fold (Table 3). Among taurine responsive genes involved in protein or amino acid metabolism, four genes were up-regulated more than 1.5-fold and ten genes were down-regulated more than two-fold (Table 4). Interestingly, products of those four genes up-regulated by taurine (branched chain aminotransferase 2, branched-chain aminotransferase 1, branched-chain keto acid dehydrogenase E1, and HMG-CoA lyase) were all involved in branched-chain amino acid catabolism.

TAURINE-INDUCED CHANGES IN TRANSCRIPTION

123

3.2. Confirmation of Microarray Results by Real Time RT-PCR Microarray results were verified by conducting real time RT-PCR analyses using identical RNA samples. We selected genes related to metabolism (glycerophosphate Oacyltransferase, branched chain keto acid dehydrogenase E1, beta polypeptide, branched chain aminotransferase 2, mitochondrial, and pyruvate dehydrogenase kinase isoenzyme 4) with varying expression profiles for real time RT-PCR analyses. The results of real-time RT-PCR analyses of these selected genes were consistent with our cDNA microarray data; although the fold changes in the expression level differed somewhat in the two analytical methods (Fig. 2). These results support the findings obtained from our microarray experiments and also suggest that taurine regulates the transcription of genes that are related to metabolism in the liver.

Table 2. Taurine responsive genes related to carbohydrate metabolism in HepG2 cells Gene description

Accession no.

Signal ratio (test/cont) Mean

SEM

AI672108

UDP-glucose pyrophosphorylase 2

4.6

1.0

Y08136

Sphingomyelin phosphodiesterase, acid-like 3A

4.1

1.7

AI289196

Mannosidase, alpha, class 1A, member 2

0.4

0.0

U85773

Phosphomannomutase 2

0.4

0.1

AA203426

KIAA1838

0.3

0.1

U54617

Pyruvate dehydrogenase kinase isoenzyme 4

0.3

0.0

AI767809

Mannosidase, alpha, class 2A, member 1

0.2

0.1

NM_002711

Protein phosphatase 1 regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)

0.2

0.0

Hybridization intensity normalized to Sacharomyces cerevisae intergenic sequence mRNA expression of repeated microarray experiments were expressed as mean and SEM of triplicate independent experiments.

4. DISCUSSION HepG2 cells express proteins involved in cholesterol and triglyceride metabolism (Javitt, 1990) and secrete many human plasma proteins (Knowles et al., 1980). Both HepG2 cells and freshly isolated human hepatocytes have similar glucuronidation and cytochrome reductase activities, but differ in microsomal epoxide hydrolase activity (Grant et al., 1988). Taurine-responsive genes identified from our cDNA microarray analyses do not obviously encompass the whole profile of genes involved in carbohydrate, lipid and protein/amino acid metabolism, since the cDNA chip used in the current study holds 8,170 genes which account for only 20% of total genes expressed in human tissues.

S-H. PARK ET AL.

124

Table 3. Taurine responsive genes related to lipid metabolism in HepG2 cells Gene description

Accession no.

Signal ratio(test/control) Mean

SEM

AF043937

Glyceronephosphate O-acyltransferase

3.1

0.3

AB014547

Myotubularin related protein 4

2.2

0.6

NM_002660

Phospholipase C, gamma 1

0.4

0.1

AI767533

0.3

0.1

AI913528

Phosphate cytidylyltransferase 1, choline, alpha isoform Selenoprotein I

0.3

0.1

X87176

Hydroxysteroid (17-beta) dehydrogenase 4

0.2

AA993882

Geranylgeranyl diphosphate synthase 1

0.1

0.0

J02883

Colipase, pancreatic

0.1

0.0

Table 4. Taurine responsive genes related to protein or amino acid metabolism Accession no.

Gene description

Signal ratio(test/cont) Mean

SEM

U68418

Branched-chain aminotransferase 2, mitochondrial

2.1

0.5

AI970531

Branched-chain aminotransferase 1, cytosolic

1.6

0.0

AI795940

2.2

0.1

NM_000191

Branched-chain keto acid dehydrogenase E1, beta polypeptide HMG-CoA lyase

1.8

0.2

AB007887

KIAA0427

0.4

0.1

U15932

Dual specificity phosphatase 5

0.4

0.0

X66362

PCTAIRE protein kinase 3

0.4

0.0

AK022339

Seryl-tRNA synthetase

0.3

0.1

M98252

Procollagen-lysine 1, 2-oxoglutarate 5dioxygenase 1

0.3

0.0

X95648

Eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa Tyrosine aminotransferase

0.3

0.1

0.2

0.0

0.2

0.0

0.1

0.0

0.1

NM_000353 Y18483 AI249145 AI884353

Solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) Mitochondrial translational release factor 1

TAURINE-INDUCED CHANGES IN TRANSCRIPTION

125

Figure 2. Confirmation of cDNA microarray results by real-time RT-PCR analyses. Results are expressed as the fold changes normalized to ȕ-actin mRNA expression. GPAT, glyceronephosphate O-acyltransferase; BCKADH, branched-chain keto acid dehydrogenase E1, beta polypeptide; BCAT2, branched chain aminotransferase 2, mitochondrial; PDHK, pyruvate dehydrogenase kinase, isoenzyme 4.

Two carbohydrate metabolism-related genes up-regulated by taurine are involved in glycogen metabolism in hepatocytes. UDP-glucose pyrophosphorylase 2 catabolizes the transfer of a glucose moiety from glucose-1-phosphate to MgUTP, forming UDP-glucose and MgPPi. Since UDP-glucose is a direct precursor of glycogen in the liver and muscle tissues, taurine-induced up-regulation of UDP-glucose pyrophosphorylase 2 expression might be related to enhanced glycogen synthesis in taurine-treated hepatocytes. Protein phosphatase 1 (PP1), regulatory subunit 3A binds to muscle and liver glycogen with high affinity and enhances dephosphorylation of glycogen synthase and glycogen phosphorylase. Both glycogen synthase and glycogen phosphorylase are tightly regulated via phosphorylation. Glycogen synthase become active when phosphorylated, while glycogen phosphorylase become inactive when dephosphorylated. Our result of decreased PP1 expression by taurine indicates that taurine appears to activate glycogen synthase but inactivate glycogen phosphorylase. This result, taken together with the increased UDP-glucose pyrophosphorylase 2 expression by taurine, led us to hypothesize that taurine enhances glycogen synthesis in the liver. Pyruvate dehydrogenase kinase (PDK) inactivates pyruvate dehydrogenase complex (PDC) by phosphorylating serine residues of the E1D component of the complex. Four isoenzymes of PDK have been identified in the human genome, and the expression level of pyruvate dehydrogenase kinase, isoenzyme 4 (PDK4) is a major determinant of PDK activity (Sugden et al., 2000). PDC catalyzes the conversion of pyruvate to acetyl-CoA, the precursor for fatty acid synthesis and energy production via the TCA cycle. In the well-fed state, the PDC is relatively active and generates acetyl-CoA, while in the starved state PDC is relatively inactive, enabling the body to conserve three-carbon compounds (pyruvate, lactate, and alanine) for gluconeogenesis (Sugden et al., 1989). The latter

126

S-H. PARK ET AL.

helps to maintain euglycemia during starvation but exacerbates hyperglycemia in diabetes (Harris et al., 2001). Huang et al. (2002) have shown that glucocorticoids and peroxisome proliferator-activated receptor D (PPARD) ligands induce PDK4 expression and insulin inhibits these effects in a rat hepatoma cell line. Regulation of PDC activity is therefore important for the control of glucose and lipid metabolism. Taurine-induced downregulation of hepatic PDK4 gene expression observed in the current study leads to the hypothesis that taurine increases PDC activity, generating acetyl-CoA for further oxidation of three-carbon compounds via TCA cycle. Our results of cDNA-microarray and real-time RT-PCR indicate that taurine upregulated the expression of four enzymes involved in branched-chain amino acid (BCAAs) catabolism. Branched-chain amino acid aminotransferases (BCAT) are pyridoxal phosphate-dependent enzymes that catalyze reversible transamination of the L-branched-chain amino acids to their respective D-keto acids. Branched-chain aminotransferase 2 mitochondrial gene and branched-chain aminotransferase 1 cytosolic gene encode the mitochondrial and cytosolic forms of the enzyme branched-chain amino acid transaminase, respectively. Branched-chain keto acid dehydrogenase is involved in oxidative decarboxylation and subsequent dehydrogenation of branched-chain D-keto acid. 3-Hydroxy-3-methylglutaryl-CoA lyase (HMG-CoA lyase) is a mitochondrial matrix enzyme that catalyzes the cleavage of HMG-CoA to acetoacetic acid and acetyl-CoA; the last step of both ketogenesis and leucine catabolism. It is believed that BCAAs contribute to energy metabolism during exercise as energy sources and substrates to expand the pool of tricarboxykic acid cycle intermediates (Shimomura et al., 2004). It is hypothesized that taurine improves the capacity of BCAA oxidation in the liver, which could be beneficial under the circ*mstances of enlarged hepatic pool of BCAAs provided as dietary supplements. Whether taurine accelerates the contribution of BCAAs as energy sources during exercise needs to be confirmed in the skeletal muscle. Tyrosine aminotransferase is present in the liver and catalyzes the conversion of L-tyrosine into p-hydroxyphenylpyruvate. Procollagen-lysine 1,2-oxoglutarate 5-dioxy genase 1 (lysyl hydroxylase) catalyzes the formation of hydroxylysine in collagens and other proteins with collagen-like amino acid sequences, by the hydroxylation of lysine residues in X-lys-gly sequences. The resultant hydroxylysyl groups are the attachment sites for carbohydrates in collagen and thus critical for the stability of intermolecular cross-links. Physiological significance of the taurine-induced down-regulation of tyrosine aminotransferase or lysyl hydroxylase is not clear at the present time.

5. CONCLUSIONS Taurine-induced changes in expression profiling of HepG2 cells were assessed using a cDNA microarray technology and confirmed by real time RT-PCR analyses. Among known genes regulated by taurine, 87 genes were up-regulated and 206 genes downregulated more than two-fold. Among these 293 taurine-responsive genes, 30 genes were implicated in the processes of carbohydrate, lipid or protein/amino acid metabolism. Taurine-induced up-regulation of UDP-glucose pyrophosphorylase 2 and down-regulation of protein phosphatase 1 regulatory subunit 3A expressions lead to a hypothesis that taurine enhances glycogen synthesis in the liver. Taurine-induced down-regulation of

TAURINE-INDUCED CHANGES IN TRANSCRIPTION

127

hepatic pyruvate dehydrogenase kinase isoenzyme 4 expression suggests that taurine increases pyruvate dehydrogenase complex activity, generating acetyl-CoA for further oxidation of three-carbon compounds via TCA cycle. Our results of cDNA-microarray and real-time RT-PCR also indicated that taurine up-regulated expressions of four enzymes involved in branched-chain amino acid catabolism (branched-chain amino acid aminotransferases 2; mitochondrial, branched-chain aminotransferase 1, cytosolic; branched-chain keto acid dehydrogenase; 3-hydroxy-3-methylglutaryl-CoA lyase). Our microarray results of hepatic gene expression profiling would provide further insights into molecular actions of taurine in metabolic regulations.

6. ACKNOWLEDGMENTS This work was supported by a grant No. R01-1999-000-00128-0 from the Basic Research Program of the Korea Science & Engineering Foundation (KOSEF), Korea.

7. REFERENCES Balkan, J., Dogru-Abbasogl, S., Kanbagli, O., Cevikbas, U., Aykac-Toker, G., and Uysal, M., 2001, Taurine has a protective effect against thioacetamide-induced liver cirrhosis by decreasing oxidative stress, Hum. Exp. Toxicol. 20:251. Bitoun, M. and Tappaz, M., 2000a, Gene expression of taurine transporter and taurine biosynthetic enzymes in brain of rats with acute or chronic hyperosmotic plasma; a comparative study with gene expression of myo-inositol transporter, betaine transporter and sorbitol biosynthetic enzyme, Mol. Brain Res. 77:10. Bitoun, M. and Tappaz, M., 2000b, Gene expression of the transporters and biosynthetic enzymes of the osmolytes in astrocyte primary cultures exposed to hyperosmotic conditions, Glia 32:165. Chen, Y. X., Zhang, X. R., Xie, W. F., and Li, S., 2004, Effects of taurine on proliferation and apoptosis of hepatic satellite cells in vitro, Hepatobiliary Pancreat. Dis. Int. 3:106. Danielsson, H., 1963, Present status of research on catabolism and excretion of cholesterol, Adv. Lipid Res. 1:335. Davison, A. N. and Kaczmarec, L. K., 1971, Taurine - a possible neurotransmitter, Nature 234:107. Dawson, J. R., Adams, D. J., and Wolf, C. R., 1985, Induction of drug metabolizing enzymes in human liver cell line HepG2, FEBS Lett. 183:219. Dinçer, S., Özenirler, S., Öz, G., Akyol, G., and Özogul, C., 2002, The protective effect of taurine pretreatment on carbon tetrachloride-induced hepatic damage - a light and electron microscopic study, Amino Acids 22:417. Gandhi, V. M., Cherian, K. M., Mulky, M. J., 1992, Hypolipidemic action of taurine in rats, Ind. J. Exp. Biol. 30:413. Harris, R. A., Huang, B., and Wu, P., 2001, Control of pyruvate dehydrogenase kinase gene expression, Adv. Enzyme Regul. 41:269. Huang, B., Wu, P., Bowker-Kinley, M. M., and Harris, R. A., 2002, Regulation of pyruvate dehydrogenase kinase expression by peroxisome proliferator-activated receptor-D ligands, glucocorticoids, and insulin, Diabetes 51:276. Huxtable, R. J., 1987, From heart to hypothesis: a mechanism for the calcium modulatory actions of taurine, Adv. Exp. Med. Biol. 217:371. Ito, T., Fujio, Y., Hirata, M., Takatani, T., Matsuda, T., Muraoka, S., Takahashi, K., and Azuma, J., 2004, Expression of taurine transporter is regulated through the TonE (tonicity-responsive element)/TonEBP (TonE-binding protein) pathway and contributes to cytoprotection in HepG2 cells, Biochem. J. 382:177. Javitt, N. B., 1990, HepG2 cells as a resource for metabolic studies: lipoprotein, cholesterol, and bile acids, FASEB J. 4:161. Knowles, B. B., Howe, C. C., and Aden, D. P., 1980, Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen, Science 209:497. Nieminen, M. L., Tuomisto, L., Solatunturi, E., Eriksson, L., and Paasonen, M. K., 1988, Taurine in the osmoregulation of the Brattleboro rat, Life Sci. 42:2137.

128

S-H. PARK ET AL.

Nishimura, N., Umeda, C., Oda, H., and Yokogoshi, H., 2003, The effect of taurine on the cholesterol metabolism in rats fed diets supplemented with cholestyramine or high amounts of bile acid, J. Nutr. Sci. Vitaminol. (Tokyo) 49:21. Obinata, K., Maruyama, T., Hayashi, M., Watanabe, T., and Nittono, H., 1996, Effect of taurine on the fatty liver of children with simple obesity, Adv. Exp. Med. Biol. 403:607. Park, T., Lee, K., and Um, Y., 1998, Dietary taurine supplementation reduces plasma and liver cholesterol and triglyceride concentrations in rats fed a high-cholesterol diet, Nutr. Res. 18:1559. Pasantes-Morales, H., Wright, C. E., and Gaull, G. E., 1985, Taurine protection of lymphoblastoid cells from iron-ascorbate induced damage, Biochem. Pharmacol. 34:2205. Schuller-Levis, G. B. and Park, E., 2003, Taurine: new implications for an old amino acid, Microbiol. Lett. 226:195. Shimomura, T., Murakami, T., Nakai, N., Nagasaki, M., and Harris, R. A., 2004, Exercise promotes BCAA catabolism: effects of BCAA supplementation on skeletal muscle during exercise, J. Nutr. 134:1583S. Sugden, M. C., Holness, M. J., and Palmer, T. N, 1989, Fuel selection and carbon flux during the starved-to-fed transition, Biochem. J. 263:313. Sugden, M. C., Kraus, A., Harris, R. A., and Holness, M. J, 2000, Fibre-type specific modification of the activity and regulation of skeletal muscle pyruvate dehydrogenase kinase (PDK) by prolonged starvation and refeeding is associated with targeted regulation of PDK isoenzyme 4 expression, Biochem. J. 346:651. Waterfield, C. J., 1994, Determination of taurine in biological samples and isolated hepatocytes by high performance liquid chromatography with fluorometric detection, J. Chromatogr. 657:37.

THE IMPORTANT ROLE OF TAURINE IN OXIDATIVE METABOLISM Svend Høime Hansen,1 Mogens Larsen Andersen, Henrik Birkedal, Claus Cornett, and Flemming Wibrand 1. ABSTRACT Several studies have demonstrated that especially high taurine concentrations are found in tissues with high oxidative activity, whereas lower concentrations are found in tissues with primary glycolytic activity. Based on such observations, we have studied if taurine is involved in mitochondrial oxidation. Several pieces of information have demonstrated taurine localisation in the mitochondria. We have developed a general biochemical model with preliminary data demonstrating the important role of taurine as mitochondrial matrix buffer for stabilising the mitochondrial oxidation. The model can have far-reaching perspectives, e.g., explaining the often-suggested anti-oxidative role of taurine, in contrast to the fact that taurine is very difficult to chemically oxidise. By stabilising the environment in the mitochondria, taurine will prevent leakage of the reactive compounds formed in the reactive mitochondrial environment and thus indirectly act as an antioxidant. Consequently, the model represents a new concept for understanding mitochondrial dysfunction by emphasising the importance of taurine for providing sufficient pH buffering in the mitochondrial matrix.

2. INTRODUCTION Taurine is found in all animal cells typically in millimolar concentrations, e.g., 5-50 mM (Jacobsen and Smith, 1968), whereas the concentration in plasma and extracellular fluids is much lower, typically 50-200 µM. Several different actions have been ascribed to taurine, e.g. bile acid conjugation and as an intracellular osmolyte. However, despite the ubiquitous distribution and several reviews on the action of taurine in physiology and pathophysiology (Huxtable, 1992; Hansen, 2001, 2003), the overall role of taurine is still disputed. 1

Department of Clinical Biochemistry 3-01-3, Rigshospitalet, Copenhagen University Hospital, DK-2100 Copenhagen, Denmark. E-mail: [emailprotected] (corresponding author)

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

129

S. H. HANSEN ET AL.

130

3. OXIDATIVE TISSUES AND TAURINE When considering the tissue localisation of taurine, it is evident that the highest concentrations are found in highly energy-consuming tissue, like retina, nerves, kidney, heart, and oxidative muscle tissue in general (Jacobsen and Smith, 1968). Several studies exist on taurine distribution in muscles comparing oxidative and glycolytic muscle types or fibre types (e.g. Aristoy and Toldrá, 1998; Cornet and Bousset, 1999). In the reports from such studies, the differences in distribution of taurine, carnosine, and anserine are conspicuous (see Table 1).

Table 1. Carnosine, anserine, and taurine content in glycolytic and oxidative porcine muscles Compound

Carnosine (ȕ-alanyl-L-histidine) Anserine (ȕ-alanyl-L-1-methylhistidine)

Taurine

Glycolytic muscle Longissimus dorsi

Oxidative muscle Masseter

10-15 µmol/g

1-2 µmol/g

1-3 µmol/g

15-20 µmol/g

The concentrations are adapted from Aristoy and Toldrá (1998) and Cornet and Bousset (1999).

Carnosine and anserine are recognised as an intracellular buffer for buffering lactate formed by glycolysis and is obviously found in high concentration in the glycolytic muscle and low concentration in the oxidative muscle. On the contrary, taurine is found in high concentrations in the oxidative muscle and low concentration in the glycolytic muscle. Such preferential localisation of taurine in oxidative tissue indicates a possible importance for mitochondrial function.

4. SUBCELLULAR DISTRIBUTION OF TAURINE The concentration gradient across the cellular membrane clearly demonstrates the action of the ATP-dependent taurine transporter. However, as seen from the reviews on taurine distribution, the taurine concentrations vary significantly among the different tissue types. Although the activity of the taurine transporter might depend on the specific tissue or the cell type within the tissue, it seems more likely to explain the variation in taurine distribution by applying a two- (or multi-) compartment model. In such a model different taurine concentrations are allowed in the subcellular compartments due to upconcentration in specific organelles. The total taurine concentration in the tissue will thus depend on the organelle distribution within the cells in the tissue. Such a multicompartmental model requires subcellular taurine transporter activity, as found in a recent study (Voss et al., 2004) on the recognition of taurine transporter with primary antibodies. However, no association with any specific organelle was demonstrated.

TAURINE AND OXIDATIVE METABOLISM

131

5. MITOCHONDRIAL LOCALISATION Immunocytochemical techniques have been developed to study tissue and subcellular distribution of taurine. Such studies demonstrated that taurine was distributed in all cellular subcompartments. However, in some organelles including the mitochondria increased immunoreactivity was reported indicating taurine localisation in the mitochondria (e.g. Ottersen, 1988; Terauchi and Nagata, 1993, Lobo et al., 2000). Recent studies on mitchondrial tRNA have demonstrated the existence of taurinemodified uridine residues (Suzuki, 2002). Such t-RNA modification must be expected to be processed inside the mitochondrial matrix. The taurine modifications were not found in mutant tRNA from patients with mitochondrial encephalopathies, i.e., the study indicates the importance of taurine for having normal mitochondrial function. Possibly, taurine could be directly involved in the metabolic regulation of the glucose metabolism as indicated by the results on the interaction between taurine and pyruvate dehydrogenase phosphatase (Lombardini, 1997).

6. INTRACELLULAR BUFFERS AND MITOCHONDRIA Any discussion on mitochondrial function and mitochondrial oxidation in modern biochemical textbooks is focused on the importance of the pH gradient between the cytosol and the mitochondrial matrix. Energy is stored electrochemically in the pH gradient in order to produce ATP by the ATP synthase enzyme system. However, as a result of the pH gradient the mitochondrial matrix is mildly alkaline (see Fig. 1).

Figure 1. Schematic overview of cell indicating the pH gradient between the cytosol and the mitochondrial matrix. pH values adapted from Llopis et al. (1998).

The pH value of the matrix has been determined to about 8 by advanced measurements applying confocal microscopy and subcellular targeting of pH indicators based on green fluorescent protein (GFP) (e.g. Llopis et al., 1998).

S. H. HANSEN ET AL.

132

Whereas the pH control of the cytosol by glycolytic buffers like carnosine and anserine has been described (e.g. Aristoy and Toldrá, 1998; Cornet and Bousset, 1999), no discussion on pH buffering of the alkaline pH in the mitochondrial matrix seems to exist. In Table 2 ionisation constants are presented for some compounds, which are involved in physiological pH regulation, and taurine.

Table 2. Ionisation constants for some intracellular pH buffers and taurine Compound

pK value

Reference

Carbon dioxide/Bicarbonate (CO2/HCO3–)

6.35 (25°C)

Beynon and Easterby, 1996

Dihydrogenphosphate/Hydrogenphosphate (H2PO4–/HPO42–)

7.21 (25°C)

Beynon and Easterby, 1996

Carnosine

6.8 (22°C)

Deutsch and Eggleton, 1938

Anserine

7.0 (22°C)

Deutsch and Eggleton, 1938

Taurine (amino group)

9.0 (25°C) 8.6 (37°C)

Hansen et al., 2005

It must be expected that pH buffering is required for the mitochondrial matrix due to the mildly alkaline environment inside. Existence of a low-molecular pH buffer will stabilise the mitochondrial pH gradient. Among the compounds presented in Table 2 taurine is the only candidate due its pK value. When comparing with other lists of physiological buffer, the lack of compounds with the pK values in the range 8–9 is conspicuous. In addition, the mitochondrial proteins are not expected to provide adequate buffering contribution, as the protein amino acid residues does not have pK values in this range either. To summarise our analysis and observations, we now propose the following hypothesis on a very important cell physiological role of taurine: Hypothesis: Taurine acts as a pH buffer in the mitochondrial matrix and thus stabilises the mitochondrial pH gradient Preliminary experimental arguments for this hypothesis follow below. Additional thorough theoretical and experimental arguments can be found below and elsewhere (Hansen et al., 2005).

7. MITOCHONDRIAL MATRIX ENZYMES In order to obtain some experimental evidence for the hypothesis proposed, the pH dependence of some enzymes localised in the mitochondrial matrix was studied. The pH dependence of isocitrate dehydrogenase from the tricarboxylic acid cycle has been determined with the results as shown in Table 3.

TAURINE AND OXIDATIVE METABOLISM

133

Table 3. pH dependence of the isocitrate dehydrogenase activity at 37°C comparing applicaton of Tris and taurine as buffer compounds pH

Taurine

Tris

7.5 7.7 7.9 8.1 8.3 8.5 8.7 8.9 9.1 9.3 9.5

95.6 100.0 98.4 92.2 84.3 73.9 62.6 46.8 30.7 10.0 2.7

96.7 96.7 94.8 88.6 79.8 74.4 64.5 54.6 43.7 27.5 16.8

The measurement of isocitric dehydrogenase activity was performed in a final volume of 3.0 ml using a Shimadzu UV-1601 spectrophotometer. The assay was carried out as described (Bergmeyer, 1974) in a medium containing 80 mM Na2SO4, 0.44 mM DL-isocitric acid, 0.5 mM E-nicotinamide adenine dinucleotide phosphate, 0.2 mM manganese chloride, 0.015 U/ml isocitric dehydrogenase (from pig heart) (Sigma), and for pH buffering 40 mM of taurine or Tris. pH of the medium was adjusted to the indicated pH with H2SO4 or NaOH at 37qC. The activity was determined from the linear increase in absorbance at 355 nm (NADPH). Data are reported as mean of 6-8 determinations and normalised relatively to the maximum activity observed. As seen from the data in Table 3 no significant difference is observed in enzyme activity using taurine instead of the traditional research buffer Tris. Actually, it seems that taurine inhibits enzyme activity at pH > 9 better than Tris. Additional examples on important metabolic enzymes localised in the mitochondrial matrix are the acyl-CoA dehydrogenase enzymes (ACADs), which are primarily responsible for performing the fatty acid ȕ-oxidation. The original mechanistic studies on these enzymes demonstrated strong pH activity dependence favouring mildly alkaline conditions at pH 8.0-8.5 (Reinsch et al., 1980, Schmidt et al., 1981) as seen in Fig. 2. In addition, to maintain a reasonably constant enzyme activity, the steep activity increase with pH immediately demonstrates a requirement for buffering the enzyme environment, i.e. buffering of the mitochondrial matrix. Additional information on the ACADs can be found in recent studies (Ghisla and Thorpe, 2004, Hansen et al., 2005). Several different ACADs were studied with different substrate specificity depending on fatty acid chain length. These studies demonstrated similar activity profiles to the profile in Fig. 2, i.e., mildly alkaline pH is required for having reasonable fatty acid ȕ-oxidation activity. In case of insufficient pH buffering, reduced enzyme activity must be expected, and, consequently, impaired mitochondrial fatty acid oxidation will be observed.

134

S. H. HANSEN ET AL.

Figure 2. pH dependence of fatty acyl-CoA-dehydrogenase activity monitored through the reduction of electron transfer flavoprotein at 25°C. Phosphate buffer (pH 6.5 and 7.0) or Tris buffer (pH > 7.5) was used for the assay. The figure is reproduced from Schmidt et al. (1981), in which the experimental procedures are described in details.

8. ANTIOXIDATIVE ROLE OF TAURINE AND FURTHER PERSPECTIVES Often taurine has been presented as an antioxidant despite the fact that the molecule is very stable and difficult to oxidise. However, by applying the hypothesis presented here, an indirect antioxidative role can be ascribed to taurine by maintaining mitochondrial oxidation and stabilising the oxidative environment and thus reduce the leakage of the reactive compounds formed inside mitochondria. On the contrary, taurine depletion will destabilise the oxidative environment with increased release of reactive oxygen species as a likely consequence. This situation will contribute to mitochondrial dysfunction. Several clinical conditions have been reported as related to mitochondrial dysfunction, e.g., type 2 diabetes (Lowell and Shulman, 2005). Further studies are required pursuing the relationship between mitochondrial dysfunction and alterations in the cellular or mitochondrial composition like taurine depletion. However, the hypothesis presented focusing on the possible role of taurine as mitochondrial matrix buffer represents a new environmental concept for the understanding of mitochondrial dysfunction.

TAURINE AND OXIDATIVE METABOLISM

135

9. ACKNOWLEDGMENTS The research project has been supported by the Danish Ministry of Health through the VIFAB programme. Journal of Biological Chemistry is acknowledged for providing permission for reproducing Fig. 2.

10. REFERENCES Aristoy, M. C. and Toldrá, F., 1998, Concentration of free amino acids and dipeptides in porcine skeletal muscles with different oxidative patterns, Meat Sci. 50:327-332. Bergmeyer, H. U., 1974, Methods of Enzymatic Analysis, 2nd edn, vol. 2, Verlag Chemie, Weinheim, pp. 624627. Beynon, R. J. and Easterby, J. S., 1996, Buffer Solutions, IRL Press at Oxford University Press, Oxford, UK. Cornet, M. and Bousset, J., 1999, Free amino acids and dipeptides in porcine muscles: differences between ‘red’ and ‘white’ muscles, Meat Sci. 51:215-219. Deutsch, A. and Eggleton, P., 1938, The titration constants of anserine, carnosine and some related compounds, Biochem. J. 32:209-211. Ghisla, S. and Thorpe, C., 2004, Acyl-CoA dehydrogenases, Eur. J. Biochem. 271:494-508. Hansen, S. H., 2001, The role of taurine in diabetes and the development of diabetic complications, Diab. Metab. Res. Rev. 17:330-346. Hansen, S. H., 2003, Taurine homeostasis and its importance for physiological functions, in: Metabolic and Therapeutic Aspects of Amino Acids in Clinical Nutrition, L. A. Cynober, ed., CRC Press, Boca Raton, pp. 739-747. Hansen, S. H., Andersen, M. L., Birkedal, H., Cornett, C., Ghisla, S., Gradinaru, R., and Wibrand, F., 2005, Mitochondrial pH gradient and oxidation stabilised by matrix buffering. A role for taurine in animal cells, Submitted. Huxtable, R. J., 1992, Physiological actions of taurine, Physiol. Rev. 72:101-163. Jacobsen, J. G. Smith, L. H., 1968, Biochemistry and physiology of taurine and taurine derivatives, Physiol. Rev. 48:424-511. Llopis, J., McCafferty, J. M., Miyawaki, A., Farquhar, M. G., and Tsien, R. Y., 1998, Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins, Proc. Natl. Acad. Sci. USA 95:6803-6808. Lobo, M. V. T., Alonso, F. J. M. and Martín del Río, R., 2000, Immunocytochemical localization of taurine in different muscle cells types of the dog and rat, Histochem. J. 32:53-61. Lombardini, J. B., 1997, Identification of a specific protein in the mitochondrial fraction of the heart whose phosphorylations is inhibited by taurine. Amino Acids 12:139-144. Lowell, B. B. and Shulman, G. I., 2005, Mitochondrial dysfunction and type 2 diabetes, Science 307:384-387. Ottersen O. P., 1988, Quantitative assessment of taurine-like immunoreactivity in different cell types and processes in rat cerebellum: an electronmicroscopic study based on a postembedding immunogold labelling procedure, Anat. Embryol. (Berl.) 178:407-421. Reinsch, J., Katz, A., Wean, J., Aprahamian, G., and McFarland, J. T., 1980, The deuterium isotope effect upon the reaction of fatty acyl-CoA dehydrogenase and butyryl-CoA, J. Biol. Chem. 255:9093-9097. Schmidt, J., Reinsch, J., and McFarland, J. T., 1981, Mechanistic studies on fatty acyl-CoA dehydrogenase, J. Biol. Chem. 256:11667-11670. Suzuki, T., Suzuki, T., Wada, T., Saigo, K., and Watanabe, K., 2002, Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases, EMBO J. 21:65816589. Terauchi, A. and Nagata, T., 1993. Observation on incorporation of 3H-taurine in mouse skeletal muscle cells by light and electron microscopic radioautography, Cell. Mol. Biol. 39:397-404. Voss, J. W., Pedersen, S. F., Christensen, S. T., and Lambert, I. H., 2004. Regulation of the expression and subcellular localization of the taurine transporter TauT in mouse NIH3T3 fibroblasts, Eur. J. Biochem. 271:4646-4658.

Department of Clinical Biochemistry 3-01-3, Rigshospitalet, Copenhagen University Hospital, DK-2100 Copenhagen, Denmark. E-mail: [emailprotected] (corresponding author)

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

129

S. H. HANSEN ET AL.

130

Table 1. Carnosine, anserine, and taurine content in glycolytic and oxidative porcine muscles Compound

Carnosine (ȕ-alanyl-L-histidine) Anserine (ȕ-alanyl-L-1-methylhistidine)

Taurine

Glycolytic muscle Longissimus dorsi

Oxidative muscle Masseter

10-15 µmol/g

1-2 µmol/g

1-3 µmol/g

15-20 µmol/g

The concentrations are adapted from Aristoy and Toldrá (1998) and Cornet and Bousset (1999).

TAURINE AND OXIDATIVE METABOLISM

131

Figure 1. Schematic overview of cell indicating the pH gradient between the cytosol and the mitochondrial matrix. pH values adapted from Llopis et al. (1998).

S. H. HANSEN ET AL.

132

Table 2. Ionisation constants for some intracellular pH buffers and taurine Compound

pK value

Reference

Carbon dioxide/Bicarbonate (CO2/HCO3–)

6.35 (25°C)

Beynon and Easterby, 1996

Dihydrogenphosphate/Hydrogenphosphate (H2PO4–/HPO42–)

7.21 (25°C)

Beynon and Easterby, 1996

Carnosine

6.8 (22°C)

Deutsch and Eggleton, 1938

Anserine

7.0 (22°C)

Deutsch and Eggleton, 1938

Taurine (amino group)

9.0 (25°C) 8.6 (37°C)

Hansen et al., 2005

TAURINE AND OXIDATIVE METABOLISM

133

Table 3. pH dependence of the isocitrate dehydrogenase activity at 37°C comparing applicaton of Tris and taurine as buffer compounds pH

Taurine

Tris

7.5 7.7 7.9 8.1 8.3 8.5 8.7 8.9 9.1 9.3 9.5

95.6 100.0 98.4 92.2 84.3 73.9 62.6 46.8 30.7 10.0 2.7

96.7 96.7 94.8 88.6 79.8 74.4 64.5 54.6 43.7 27.5 16.8

134

S. H. HANSEN ET AL.

TAURINE AND OXIDATIVE METABOLISM

135

CHARACTERIZATION OF TAURINE AS INHIBITOR OF SODIUM GLUCOSE TRANSPORTER HaWon Kim,1 Alexander John Lee,1 Seungkwon You,2 Taesun Park,3 and Dong Hee Lee1*

1. ABSTRACT The most characterized roles of taurine include osmoregulator and membranestabilizing activities. However, much remains to be understood about its role in human physiology concerning its anti-hyperglycemic effect. Studies indicate that taurinesupplemented diet helps alleviate hyperglycemia or insulin resistance. This hypoglycemic effect has been postulated as taurine helping to increase the excretion of cholesterol. Alternatively, this study investigated the effect of taurine on glucose transporter using heterologous expression of sodium-glucose transporter-1 (SGLT-1). SGLT-1 was expressed in Xenopus oocytes and the effect of taurine on the expressed SGLT-1 was analyzed utilizing 2-deoxy-D-glucose (2-DOG) uptake and voltage clamp studies. In the oocytes expressing SGLT-1, taurine was shown to inhibit SGLT-1 activity compared to the non-treated controls in a dose-dependent manner. In the presence of taurine, the glucose uptake was greatly inhibited and the glucose-generated current was significantly inhibited. Synthetic taurine analogs were also shown to be effective in inhibiting SGLT-1 activity in a manner comparable to taurine. These effects might offer a promising opportunity in designing functional foods with anti-hyperglycemic potential by supplementing taurine and its analogs to the diet. Key words: SGLT-1, Taurine, Xenopus oocytes, voltage clamp, diabetes

1 2

Department of Life Sciences, University of Seoul, 90 Jeonnong-Dong, Dongdaemun-Gu Seoul, Korea 130-743, Division of Biotechnology and Genetic Engineering, Korea University, 3 Department of Food and Nutrition, Yonsei University, *Corresponding author (E-mail: [emailprotected]).

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

137

138

H. W. KIM ET AL.

2. INTRODUCTION Taurine has been highly regarded as an effective medicine with anti-aging and osmo-regulatory function (Satsu et al., 2003; Takashi et al., 2004). Lowering the blood sugar content is considered one of the most effective outcomes among numerous others exerted by taurine (Hansen et al., 2001; Arany et al., 2004; Di Leo et al., 2004). Despite many researchers’ efforts to understand the basis of the hypoglycemic effect of taurine, the mechanism remains at large to date. The core of understanding the hypoglycemic mechanism lies in an analysis of glucose transport in the presence of taurine as compared to known glucose transporter inhibitors (Oulianova et al., 2001). Two lines of the glucose transporter have been identified in humans: the facilitated diffusion glucose transporters (GLUTs) and the sodium-dependent glucose transporters (SGLTs) (Doege et al., 2001). Both classes of transporters are integral membrane proteins that mediate the transport of glucose and structurally related substances across membranes. Especially, SGLT-1 has an unusual affinity constant (K0.5=0.4 mM) for glucose when compared to other SGLTs whose K0.5 ranges 2-6 mM and which re-absorb the majority of glucose from the kidney’s proximal tubule despite their small capacity. Inhibition of SGLT-1 would therefore accelerate removal of glucose from urine by blocking the re-absorption activity. The GLUT gene encodes a protein involved in the active transport of glucose and galactose into eukaryotic and some prokaryotic cells. Seven different GLUTs have been identified to date (Ader et al., 2001; Sheppers et al., 2004). While the GLUTs catalyze glucose transport via a passive mechanism, the members of the SGLTs mediate active transport of glucose against its concentration gradient (Wood and Trayhun, 2003). Under certain circ*mstances, a low-glucose diet may circumvent the problem of glucose uptake via GLUTs. However, the glucose uptake via SGLTs continues in spite of the diet low in glucose. The human SGLT family consists of two members. The SGLT-1 transports glucose and galactose with similar affinity while the SGLT-2 highly prefers glucose to galactose. This sodium-dependent transport of D-glucose by SGLT is promoted by an inside negative membrane potential and acidity, and inhibited by phloridzin, a specific competitor of SGLT. This study focused on the inhibition of SGLT-1 by taurine to determine its probable mechanism as a hypoglycemic agent since SGLT-1 contributes significantly to sustaining high blood glucose with its reabsorbing potential against the concentration gradient. The Xenopus oocyte expression system has been proven effective to study the characteristics of glucose transporters (Mandal et al., 2003). Human SGLT-1 was expressed in Xenopus laevis oocytes and the effect of taurine and its analogs was studied using electrophysiological measurement and D-glucose influx studies.

3. MATERIALS AND METHODS 3.1. Expression of SGLT-1 cRNA in Oocytes The cRNA for human SGLT-1 was synthesized from pSP6-hSGLT-1 with Sp6 polymerase according to the manufacturer’s protocol (Promega, WI, USA). An ovary was manually removed from an adult Xenopus and defolliculated oocytes were injected with hSGLT-1 cRNA as described by Lee et al. (1998, 1995). Before microinjection, the

TAURINE AS SGLT-1 INHIBITOR

139

oocytes were washed copiously in Barth’s solution [5 mM KOH, 100 mM NaOH, 0.5 mM CaCl2, 2 mM MgCl2, 100 mM methanesulfonic acid, and 10 mM HEPES (pH 7.4)], and stage 4 or 5 oocytes were injected with 50 nl of injection mixture containing 50 ng cRNA either of hSGLT-1 or human EAAC-1 glutamate transporter. Following injection, the oocytes were incubated in Barth’s solution at 14oC for 24 h before glucose uptake and electrophysiological assays. 3.2. Analysis of hSGLT-1 Expression After microinjection and incubation, SGLT-1 was extracted in phosphate-buffered saline (PBS) with 0.2% mercaptoethanol using a Dounce hom*ogenizer. In other experiments, the transmembrane segment of SGLT-1 was labeled by surface biotinylation according to Lee et al. (1998). The injected oocytes were biotinylated with 1.0 mg/ml EZ-link-sulfo-NHS-LC-biotin (Pierce, Rockford, USA) and precipitated with Neutravidin-conjugated beads. The precipitated proteins were electrophoresed and detected by Western blotting with antiserum against hSGLT-1 (Acris Antibodies, Hiddenhausen, Germany). In addition, hSGLT-1 expression was also functionally analyzed according to the rate of entry of 2-deoxy-D-[3H]glucose (2-DOG) into the oocytes as described below. Saponin (Sigma-Aldrich Biochemicals, St.Louis, USA) was used as a membrane permeability enhancer and served as a positive control for the entry of 2-DOG. 3.3. Assay ofҏ 2-Deoxy-D-[3H]Glucose Uptake Sodium-dependent glucose transport was measured according to the uptake of 3H-labeled 2-deoxy-D-glucose (2-DOG) as a non-metabolized model substrate. The 2-DOG uptake was assayed by incubating 5 oocytes in 2 mM 2-[3H]DOG (0.08 GBq/0.5 ml) with taurine concentrations ranging from 0 to 1 mM in 1 ml of Barth’s solution. After a 10-min incubation, the oocytes were thoroughly washed with cold Barth’s solution and glucose uptake was analyzed for a 30-min influx period. Entry of glucose was initiated by placing five oocytes in 1 ml of Barth’s solution containing 1.0 GBq of 2-[3H]DOG and cold 2-DOG at concentrations of 1 to 50 mM. During the incubation, a constant osmolality of 179.1 mOsm/l was achieved by adding a 1 M sucrose solution. The oocytes were then removed to a scintillation vial containing 0.5 ml of Barth’s solution and after 2 minutes transferred to another scintillation vial. Five hundred microliters of 0.1% SDS were added to both vials and mixed by vortexing. NEN scintillation co*cktail (DuPont NEN, Boston, USA) was added up to 5 ml before counting. Taurine and its three analogs were also purchased from Sigma-Aldrich Biochemicals. 3.4. Electrophysiological Experiments The two-microelectrode voltage-clamp method was employed to measure the glucose-induced current in a rapid perfusion chamber at 22-25oC with an OC-725 voltage clamp amplifier (Warner Instrument, Hamden, USA). As a negative control, the human glutamate transporters (hEAAC-1) were expressed using in vitro transcribed cRNA that were prepared similarly as SGLT-1. The oocytes were perfused in a solution containing 88 NaCl, 2 KCl, 1.8 CaCl2, and 10 HEPES-NaOH, pH 7.4 (in mM). For sodium-free solution, Na+ was replaced with choline and pH was adjusted with KOH. The electrodes

140

H. W. KIM ET AL.

were filled with 3 M KCl and the membrane potential was normally maintained at a holding potential of –50 mV. Taurine inhibition was assayed on oocytes incubated with taurine whose concentrations range from 0 to 1 mM. Data collection was performed using pCLAMP 6 software (Axon Instruments, Foster City, USA). 3.5. Kinetic Analysis of Inhibition by Taurine and Its Derivatives Zero trans influx was analyzed using 3-OMG (0.08 GBq/0.5 ml) for a 30-min influx period. The influx of 3-OMG was initiated by incubating five oocytes in 1 ml of Barth’s solution containing 1.0 GBq of 2-[3H]DOG and cold 3-OMG at concentrations from 1 to 100 mM at a constant osmolarity of 179.1 mOsm/l. The oocytes were transferred to a scintillation vial containing 0.5 ml of Barth’s solution. In the control experiments oocytes were injected with water under the same conditions, and the control transport rates were subtracted from the transport rates for oocytes expressing SGLT-1. Equilibrium-exchange influx assays were performed at 0 to 150 mM 3-OMG after overnight incubation at 18°C in 1 m1 of Barth’s solution. Osmolality was again maintained at 179.1 mOsm/l by adding 1-M sucrose. Km and Vmax values were calculated using GRAPHPAD PRISMTM software (GraphPad Software, San Diego, USA).

4. RESULTS

Figure 1. Functional expression of SGLT-1 in Xenopus oocytes. Membrane fractions were prepared from the oocytes injected with synthetic human SGLT-1 mRNA. Proteins were detected by immunoblotting using hSGLT-1. 2-DOG uptake efficiency was compared among the oocytes that were injected with water (WA) or SGLT-1 message. Following injection, the oocytes were incubated with 5-mM 2-DOG for 6 hours. The entry of 2-DOG into the oocytes was measured after copious washing with Barth’s solution. SAP refers to the oocytes treated with 0.01% saponin (w/v). SGLT5 refers to the oocytes injected with 5 ng of SGLT-1 cRNA, and SGLT10 to those injected with 10 ng of SGLT-1 cRNA.

This study investigated whether taurine could serve as an inhibitor of SGLT-1. In order to understand the mechanism of the hypoglycemic effect of taurine, the extent of inhibition by taurine and its derivatives was measured in X. laevis oocytes expressing the SGLT-1 on their membranes. Following injection of synthetic human SGLT-1 mRNA, the expressed proteins were electrophoresed and detected by immunoblotting using anti-hSGLT1. No hSGLT-1 was detected in the oocytes injected with water and saponin

TAURINE AS SGLT-1 INHIBITOR

141

(Fig. 1). In terms of activity, the uptake of 2-DOG increased in the oocytes expressing SGLT-1, and the oocytes injected with 10 ng of the SGLT-1 mRNA took up more 2-DOG than those injected with 5 ng of mRNA. These findings are consistent with previous studies (Doege et al., 2000; Olianova et al., 2001). To measure the effect of taurine on the activity of SGLT-1, voltage clamp experiments were performed. Fig. 2 shows that the oocytes expressing hSGLT-1 generated a substantial current upon addition of 100 mM D-glucose and this current was inhibited by pre-incubation with 0.5 mM phloridzin (Fig. 2A). When pre-incubated with 0.5 mM taurine (Fig. 2B), the oocytes show little or no sodium ion-induced current, similarly to the effect of phloridzin. When the oocytes were washed out with perfusion media, the electric current was induced to the level of -120 nA. When the oocytes were placed in taurine-free media, the current was restored indicating that the inhibition was reversible. Fig. 2C indicates that taurine did not affect the human Na+/glutamate co-transporter. The oocytes expressing the human Na+-glutamate cotransporter were incubated with 1 mM glutamate and approximately 100 nA was recorded as the peak current. When treated with 0.5 mM taurine (open band), the oocytes showed no significant alteration in the glutamate-induced currents, differently from those expressing SGLT-1. The oocytes also showed no change in the maximum glutamate-induced electric current after they had been washed with perfusion media to remove taurine. This indicates that taurine targets at SGLT-1 as a specific inhibitor.

Figure 2. Voltage clamp assay on glucose-induced current in a single oocyte. An oocyte expressing hSGLT-1 was subjected to electrophysiological measurements at a membrane potential of -50 mV. (A) With the addition of 100-mM glucose (closed band), the oocytes showed -150-nA Na+-inward current. Pre-treatment with 0.5 mM phloridzin for 1 minute (open band), however, inhibited generation of any significant current, even with the addition of 100-mM glucose. When washed out with the perfusion medium (dotted band) and insulted with 100 mM glucose, the oocytes resumed their electrical response. (B) When pre-incubated with 0.5 mM taurine (open band), the oocytes did not show any significant Na+-induced current, similarly to the effect of phloridzin. As in Fig. 2A, the oocytes were washed with perfusion media (dotted band), and the electric current was induced to the level of -120 nA. (C) The oocytes expressing the human Na+-glutamate cotransporter (EAAC-1) were incubated with 1 mM glutamate (striped band) and approximately 100 nA was recorded as the peak current. When treated with 0.5 mM taurine (open band), the oocytes showed no significant alteration in the glutamate-induced currents, differently from those expressing SGLT-1. The oocytes also showed no change in the maximum glutamate-induced electric current after they had been washed out with perfusion media to remove taurine (dotted band).

The inhibitory effect of taurine on SGLT-1 was analyzed in the presence of 0.5 mM 2-DOG on the basis of kinetics (Fig. 3A). The SGLT-1 activity was significantly reduced

H. W. KIM ET AL.

142

at the fixed concentration of 2-DOG, and the fractional uptake rate (V/Vo= inhibited/non-inhibited uptake rate) declined in a dose-dependent manner. In the presence of taurine, the half-saturation rate and the maximum velocity of glucose uptake were affected in a dose dependent manner. The change in the fractional uptake value is comparable with phloridzin. Fig. 3B shows that both the apparent half-saturation rate constant and the maximum velocity of zero-trans 3-OMG uptake were decreased by taurine. The reduction in the half-saturation rate constant caused by taurine was confirmed in an equilibrium-exchange experiment using 3-OMG as a glucose analog.

(A )

PZN

Taurine

(B )

Taurine(-)

Taurine (+)

2.5

[S]/V

V/V0

0.5 0 -7

-6

(log M )

-5

1.5 1 0.5 0

100

[S] (2-DO G (m M ))

Figure 3. Effects of taurine on SGLT-1 in glucose uptake. (A) The effects of taurine on SGLT-1 were measured in the presence of 0.5 mM 2-DOG. Xenopus oocytes expressing SGLT-1 were incubated with taurine (square) or phloridzin (diamond). The fractional uptake rates (V/Vo) were calculated as fractional values of the inhibited (V) and non-inhibited (Vo) uptake rate. (B) Kinetic analysis on taurine inhibition of 3-OMG uptake. The zero-trans influx of 3-OMG at the indicated concentrations was determined in the oocytes expressing SGLT-1 in the absence or presence of 0.5 mM taurine (Michaelis-Menten graphs). The equilibrium exchange influx kinetics was determined at the 3-OMG equilibrium concentrations indicated. The straight line refers to the taurine-free treatment and the dotted one to the taurine treatment. The accumulation of 3-OMG was measured for 1 h and expressed as modified by logarithmic conversion. At each time point, 5 oocytes were measured per group in the assay. The negative reciprocals of the slopes were used to plot against the 3-OMG concentrations according to the Hanes plotting application. On the y-axis, the 1/[slope] refers to the reciprocal of each absolute value (taurine-free treatment: Km=25.0 mM and Vmax=155+12; taurine-supplemented treatment: Km=4.9+1.1 and Vmax=28+6).

Unlike 2-DOG, 3-OMG is transported by SGLT-1 but not phosphorylated following its entry into the cell. At an equilibrium concentration of 100 mM 3-OMG, the rate of accumulation of 3-OMG was severely impaired by taurine. The Michaelis-Menten constants of SGLT-1 obtained in these equilibrium exchange and zero-trans influx experiments are consistent with previous reports. Taurine analogs also inhibited SGLT-1 activity (Fig. 4), hypotaurine being the most effective. This result suggests that the main skeleton of taurine functions in the inhibition of SGLT-1 and the extent of inhibition can be upgraded by changing functional groups. Screening of a chemical library could also identify even more effective taurine-based inhibitors.

TAURINE AS SGLT-1 INHIBITOR

143

R elative C urrent (% ) 90 60 30 0 Taurine

A cetylTau

H ypoTau

B-A lanine

Figure 4. Effect of taurine analogs on SGLT-1. Effect of taurine analogs on SGLT-1 was assayed using voltage clamp methods. The effects of taurine analogs on SGLT-1 were measured in the presence of 50 mM glucose. The measurements were expressed as relative values with the taurine-free value as 100%. Each column represents the mean + S.E. (n=5). The open bars refer to non-treated controls. The striated and dark ones refer to the treatment of 1 mM of each taurine analog and phloridzin, respectively. B-alanine: beta-alanine.

5. DISCUSSION The present study shows that taurine inhibits glucose transport by SGLT-1. Throughout this study, taurine consistently showed a potent inhibitory effect on the transport of glucose governed by SGLT-1. This study also indicates that taurine is a promising natural source of biologically active substances to cope with hyperglycemia. Taurine significantly decreased the inward transport of 2-DOG in Xenopus laevis oocytes expressing SGLT-1, thus underlining the potential importance of taurine and its derivatives as SGLT inhibitors. In treating diabetes, taurine should provide important alternative routes for reducing glucose levels as a specific inhibitor for SGLT. The mode of inhibition of SGLT by taurine appears to be highly specific: Lack of the inhibitory effect on EAAC-1 (sodium-glutamate transporter) expressed in the oocytes indicates that taurine serves as an actual inhibitor against SGLT-1. In the kinetic analysis, taurine significantly lowered both Km and Vmax of SGLT-1 in a dose-dependent manner. Its mode of action also resembled that of phloridzin, a known inhibitor of SGLT-1. This reduction was most likely due to a decreased affinity for the transported substrate considering that the Km was affected. Thus, it is likely that taurine affects one or more steps in transport at the point of substrate binding. Taurine also caused a more than sixfold reduction in the apparent affinity of SGLT-1 for 3-OMG. The kinetic analysis also indicated that taurine affects the equilibrium binding of glucose to the glucose transporter. This provides good evidence that taurine acts directly on SGLT-1 rather than affecting a signaling pathway leading to glucose uptake and metabolism. Taurine analogs also have potential as inhibitors of SGLT-1 despite the fact that their chemical structure differs from that of the common SGLT inhibitors. Taurine analogs inhibited glucose influx via hSGLT-1, hypotaurine giving the highest level of inhibition. These compounds can easily be synthesized in quantity, and are already listed in many

144

H.W. KIM ET AL.

commercial catalogues. Thus these compounds would therefore be readily used as potential agents to treat the problem of high blood glucose levels, especially to prevent postprandial hyperglycemia. To date, the available specific non-transportable inhibitors of SGLT-1 are glucosides of flavonoid-like polyphenols such as phloridzin. The steps in glucose transport targeted by these glucosides are well known. Since taurine differs from those glucoside and its analogs, the inhibition of SGLT-1 by taurine implies that additional steps affecting the overall performance of SGLTs might exist to be further elucidated. In the present study, taurine was tested for the hypoglycemic effect at the concentration ranging from 0.2 to 1.0 mM. These limits were adopted because phloridzin, the known SGLT-1 inhibitor, has been usually applied in this concentration range. It is undertaking to determine the working level of taurine as an anti-hyperglycemic agent in the context of physiological ramification to humans. Since this study was performed using the Xenopus oocyte systems, further study must be performed to investigate which in vivo level of taurine is relevant to treat hyperglycemia. In conclusion, the results of this study have shown that taurine can inhibit glucose transport through SGLT-1. This inhibitory effect cannot be attributed to an indiscriminative effect on transmembrane proteins. The inhibitory effect of taurine does not lie at the level of glucose metabolism; most likely taurine inhibits glucose transport via SGLT-1. The basis for the inhibitory effect of taurine relies on the step of translocation through glucose transporters. Finally, taurine can be used to treat diabetes and has a specific inhibitory effect on SGLT-1.

6. ACKNOWLEDGMENTS This research was supported by the BioGreen21 Research Grant to DHL. The authors appreciate for the financial support.

7. REFERENCES Ader, P., Blöck, M., Pietzsch, S., and Wolffram, S., 2001, Interaction of quercetin glucosides with the Na+-dependent glucose carrier (SGLT1) in rat small intestine, Cancer Lett. 162:175. Arany, E., Strutt, B., Romanus, P., Remacle, C., Reusens, B., and Hill, D. J., 2004, Taurine supplement in early life altered islet morphology, decreased insulitis and delayed the onset of diabetes in non-obese diabetic mice, Diabetologia 47:1831. Di Leo, M. A., Santini ,S. A., Silveri, N. G., Giardina, B., Franconi, F., and Ghirlanda ,G., 2004, Long-term taurine supplementation reduces mortality rate in streptozotocin-induced diabetic rats, Amino Acids 27:187. Doege, H., Bocianski, A., and Joost, H. G., 2000, Activity and genomic organization of human glucose transporter 9 (GLUT9), a novel member of the family of sugar-transport facilitators predominantly expressed in brain and leukocytes, Biochem. J. 350:771. Hansen, S. H., 2001, The role of taurine in diabetes and the development of diabetic complications, Diabetes Metab. Res. Rev. 17:330. Lee, D. H., 1998, Characterization of 27K zein as a transmembrane protein. J. Biochem. Mol. Biol. 31:196.

TAURINE AS SGLT-1 INHIBITOR

145

Lee, D. H., Selester, B, and Pedersen, K., 1995, Free movement of 27K zein in the endoplasmic reticulum, Protein Eng. 9:91. Mandal, A. Verri, T, Mandal, P. K., Storelli, C., and Ahearn, G.A., 2003, Expression of Na+/D-glucose cotransport in Xenopus laevis oocytes by injection of poly(A)(+)RNA isolated from lobster (Homarus americanus) hepatopancreas, Comp. Biochem. Physiol. A. Mol. Integr. Physiol. 135:467. Oulianova, N., Falk, S., and Berteloot, A., 2001, Two-step mechanism of phroridzin binding to the SGLT1 protein in the kidney, J. Membr. Biol. 179:223. Satsu, H., Terasawa, E., Hosokawa, Y., and Shimizu, M., 2003, Functional characterization and regulation of the taurine transporter and cysteine dioxygenase in human hepatoblastoma HepG2 cells, Biochem J. 375:441. Scheepers, A., Joost, H. G., and Schurmann, A., 2004, The glucose transporter families SGLT and GLUT: molecular basis of normal and aberrant function, J. Parent. Enteral Nutr. 28:364. Takashi, M, Satsu, H, and Shimizu, M., 2004, Physiological significance of the taurine transporter and taurine biosynthetic enzymes in 3T3-L1 adipocytes, Biofactors 21:419. Wood, I. S. and Trayhurn, P., 2003, Glucose transporters (GLUT and SGLT): expanded families of sugar transport proteins, Br. J. Nutr. 89:3.

TAURINE ATTENUATES PYRIDOXAL-INDUCED ADRENOMEDULLARY CATECHOLAMINE RELEASE AND GLYCOGENOLYSIS IN THE RAT Jagir P. Patel and Cesar A. Lau-Cam* 1. ABSTRACT The vitamin B6 vitamers, pyridoxine, pyridoxal and pyridoxamine are capable of promoting the mobilization of hepatic glycogen stores and hyperglycemia in the rat. These effects, which are dose-related and far greater with pyridoxal than with the other B6 vitamers, follow the outpouring of adrenomedullary catecholamines into the circulation. By taking advantage of this animal model, the present study was undertaken to examine the validity of a previously held view that taurine can suppress the release of adrenomedullary catecholamines. By treating Sprague-Dawley rats with intraperitoneal doses of pyridoxal, taurine, E-alanine, specific pharmacological antagonists (atropine, hexamethonium, labetalol, propranolol, verapamil) and their combinations, it was determined that the attenuating action of taurine on pyridoxal-induced glycogenolysis is centered in the adrenal gland.

2. INTRODUCTION Among the myriad of biological actions manifested by taurine (TAU) in mammalian organisms and test preparations, its role in preventing the release of catecholamines (CATs) from the adrenal gland is probably one of the least studied. In fact, the only published reports on this subject appears to have come from work by Nakagawa and Kuriyama (1975) and Kuriyama and Nakagawa (1976) describing the effects of orally administered taurine on alterations in adrenal function induced by immobilized cold stress in the rat, and manifested by a reduction in epinephrine content of the adrenal medulla and an increase in blood glucose. On the other hand, work in this laboratory on the biological actions of the vitamin B6 vitamers pyridoxal (PL), pyridoxine (PN), and pyridoxamine (PA) in the rat has shown that these pyridine *

St. John’s University, College of Pharmacy and Allied Health Professions, Jamaica, NY 11439, USA.

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

147

148

J. P. PATEL and C. A. LAU-CAM

derivatives are endowed with the ability to stimulate the release of adrenomedullary catecholamines (CATs) in a dose-dependent manner when administered by the oral or intraperitoneal routes and at doses above 100 mg/kg (Kendall, 1984; Lau-Cam et al., 1991). The outflow of CATs into the circulation is found to be followed almost immediately by an extensive mobilization of the hepatic glycogen and a marked rise in plasma glucose. The objectives of the present study were first, to determine in the rat whether TAU can attenuate the release of adrenomedullary CATs elicited by chemical stimulation with a compound such as vitamin B6, and second, to gain information on the mechanism leading to the release of CATs and the decrease in hepatic glycogen. To this effect, groups of fasted rats were separately treated with PL, TAU, ȕ-alanine (BALA), a pharmacological antagonist (adrenoceptor, muscarinic, ganglionic, calcium channel) and combinations thereof, and plasma CATs, hepatic glycogen and plasma glucose were measured at predetermined times.

3. MATERIALS AND METHODS 3.1. Animals All experiments were conducted on groups of 5 male Sprague-Dawley rats, 225250 g in weight, purchased from Taconic (Germantown, NY) and housed in groups of 5 in plastic cages, in a room maintained at a constant temperature of 21±3˚C, a constant humidity and a normal 12 h light-dark cycle. During an acclimation period of at least 3 days, the rats were fed a commercial rat diet (Purina Lab Chow, Ralston-Purina Co., St. Louis, MO) and water ad libitum. The food was removed 12 h before an experiment. 3.2. Treatments The various test compounds were administered as aqueous solutions, by the intraperitoneal route, and at a dose of 300 mg/kg (PL hydrochloride, PN, PA hydrochloride), 2.4 mmol/kg in equal divided doses (BALA, TAU), 2 mg/kg (labetalol hydrochloride = LAB, propranolol hydrochloride = PRO, phentolamine hydrochloride = PHA, verapamil hydrochloride = VER, 28 mg/kg (hexamethonium bromide = HEX) or 0.02 mg/kg (atropine sulfate = ATR). Each compound was administered 30 min before PL. When BALA or any of the pharmacological antagonists was added to TAU, they preceded the first dose of TAU by 30 min. Divided doses were administered 30 min apart and 30 min before PL. 3.3. Samples and Assays Blood samples were collected at 0, 5, 10, 15 and 30 min post-PL by the orbital sinus technique (Riley, 1960) into microtubes containing a small amount of NaFNa2EDTA, mixed well, and centrifuged at 2,500 rpm for 10 min to isolate the plasma fraction. The samples were kept on ice, pending their analysis for glucose levels, or frozen, until analyzed for CATs. Plasma glucose was measured using a commercially available kit (Procedure No. 510 from Sigma Chemical Co., St. Louis, MO). Plasma CATs (epinephrine = E, norepinephrine = NE, dopamine = DA) were measured by the

TAURINE ATTENUATES CATECHOLAMINE RELEASE

149

HPLC method with electrochemical detection described by Williams et al. (1985), after a sample cleanup by the method of Wang et al. (1999), and using 3,4-dihydroxybenzylamine as an internal standard. Livers were removed by the freeze-clamp technique of Wollenberger et al. (1960) immediately after collecting the 30 min blood sample, and kept at -70˚C until their assay for hepatic glycogen according to Keppler and Decker (1974). A sample for this purpose was prepared by hom*ogenizing a portion of frozen liver with ice-cold 0.6 M HClO4 (1 g/5 ml), neutralization of an aliquot of the hom*ogenate (0.2 ml) with 1 M KHCO3 (0.1 ml), and hydrolysis by incubation (40˚C) with a solution of amyloglucosidase containing 45 units/ml (2 ml). Following centrifugation of the suspension, the free glucose present in the supernatant was measured as described for the plasma samples. The concentrations of the various analytes were calculated from the experimental values obtained for the corresponding standard preparations, treated in identical manner as the samples. 3.4. Statistical Analysis The experimental results are reported as the mean ± SEM for n = 5. They were analyzed using a commercially available software program (SPSS Version 12.0, John Wiley & Sons, New York, NY). Differences were considered to be statistically significant at p>DA. Changes in plasma glucose were noticeable as early as 5 min post-PL and continued to rise for at least the next 25 min. The elevations in plasma glucose and decreases in hepatic glycogens levels at 30 min post-PL ranged from 15% to 337% and from 1.5% to 22%, respectively.

150

J. P. PATEL and C. A. LAU-CAM

Figure 1. Effect of PN, PA and PL on the plasma CATs of intact, splanchnectomized and adrenalectomized rats. Bars represent the mean for 5 rats. Vertical lines represent the SEM. Significance vs. intact rats (saline): ***p 20-min CKMB levels most likely indicate a progressive decrease of the leaky membrane at this early time. The higher 5-min CKMB represents the higher ability to support aerobic metabolism, that is, viability but not irreversible injury in this model. Furthermore, the greater correlation of 5-min CKMB with some parameters (GPT, GOT, LDH, CPK, LA, PA, LA/PA and HW) than that of 8-OHdG is

W. ORIYANHAN ET AL.

284

most interesting (Table 6). It suggests that CKMB could be used as an effective surrogate of 8-OHdG at 20 min and/or other apoptotic markers. The aerobic metabolic environment influences most CKMB and GPT (Table 5) and secondarily all other enzymes (Table 6). Though the 20-min CKMB of T>no-taurine hearts, it is still lower than that in control hearts (Table 5) and may explain the significantly lower LVDP and dp/dt compared to control hearts (Table 4) as the highly significant correlation indicates (Fig. 5B). Thus 5and 20-min CKMB are the determinants of LV function rather than representing injury in this model.

150 125 100

No-Tau No-Tau r2=0.6452 p< 0.0001 No-Tau

75 (all)

TAURINE (all) r2=0.3644 p< 0.0001

25 0 0.050

0.075

0.100

0.125

5' CKMB (IU/gHW/min)

3000 2500 2000

20'(all) r 2=0.5746 p=< 0.0001

20'(all including CONTROL)

20' no-tau

20' TAU CONTROL

1500 1000 500

20' no-tau 0 0.000

0.025

0.050

20' no-tau r 2=0.7184 p=0.0079

0.075

0.100

0.125

20'or CONTROL CKMB (IU/gHW/min)

Figure 5. (A) Five-min CKMB correlates positively with the eventual left ventricular function and (B) 20-min CKMB correlates with LV dp/dt. Control hearts without ischemia with the higher release of CKMB generate the greatest LV dp/dt.

The T hearts leaked non-significantly less CPK, GOT, GPT and LDH at 20 min than the no-taurine hearts (Table 5), but still more than the non-ischemic control hearts, suggesting some degree of tissue injury or greater membrane permeability. However, the correlation of 8-OHdG, CKMB, and LA (not shown) with those tissue injury markers indicates less injury than in the no-taurine hearts (Table 6, Fig. 4B). In all reported

REGIONAL TAURINE PERFUSION

285

experimental studies a better viability is associated with taurine use. Taurine preserves intracellular ATP levels in cultured cardiomyocytes (Messina and Dawson, 2000) or renal cells (Wingenfeld et al., 1996) rendered hypoxic and in hepatocytes exposed to toxins (hydrazine or 1,4-naphtoquinone; Timbrell et al., 1995). Taurine also decreases enzyme leakage from the livers subjected to re-oxygenation after the 16-h ischemic hypothermic storage (Wettstein and Haussinger, 2000). Ischemia reduces the activity of cellular defense enzymes against free radicals. Reperfusion or re-oxygenation further disturbs the delicate balance of oxidants and antioxidants. The burst of reactive oxygen species (McCord, 1988; Miyamae et al., 1996; Sharikabad et al., 2000) damages DNA (Siesjö et al., 1996; Li et al., 1997, 1999a, 1999b, 2001; Messina and Dawson, 2000; Takahashi et al., 2003). DNA oxidation results in the production of 8-OHdG that can be immunohistochemically identified and quantified (Kasai and, 1984; Toyokuni, 1999). The 8-OHdG levels increase in cardiomyocytes after myocardial infarction (Miwa et al., 2002). Myocardial reperfusion injury could be prevented by inhibiting the poly(ADP-ribose) synthetase, which increases the levels of NAD+ and decreases the levels of 8-OHdG and apoptosis as assayed by TUNEL (Yamazaki et al., 2004). We used thus 8-OHdG, CKMB, PA, and LA as surrogates of TUNEL and NAD+ assays. Thatte et al. (2004) reported that the severity of myocardial acidosis determined the extent of activation of 4 pro-apoptotic markers and LV function depression. This study demonstrates beyond any question that taurine prevents 8-OHdG generation, that is, DNA oxidative stress in the cold-preserved heart, but does not address as to which gene’s oxidation is affected and how, whether directly on DNA or indirectly via CKMB-catalyzed oxidative phosphorylation or other vital enzymes. However, the fact that taurine ameliorated ventricular function mainly by preserving CKMB activation restoring aerobic metabolism as early as 5 min after reperfusion, minimizing lactic acidosis and preventing DNA oxidation, seems unquestionable even in absence of TUNEL studies. It might be worth mentioning that subsequent TUNEL staining of the studied hearts corroborated the significantly greater number of apoptotic nuclei in 8-OHdG positive cells (Oriyanhan et al., 2005). We assume that these effects are mediated by (a) the increased protein expression of the mitochondria-stabilizing anti-apoptotic Bcl-2 and (b) decreased expression of the pro-apoptotic Bax, as well as p53, the apoptosis initiator gene (Takahashi et al., 2003). It was recently found that taurine inhibition of apoptosis involves Akt-mediated caspase-9 inactivation in cultured cardiomyocytes exposed to hypoxia (Takatani et al., 2004). Although a significantly higher pyruvic acid efflux was observed only in the 6-h preservation T hearts, taurine decreased lactic acidosis and restored better ventricular function faster post reperfusion in both normothermic and hypothermic hearts. It may thus have a place in protecting hearts during percutaneous intravascular interventions or during off-pump and on-pump cardiac surgery. The relative protective role of taurine in the hypothermic 6-h preserved hearts being far greater than in normothermic short ischemia hearts suggests that it is most effective when the ischemia/reperfusion-induced stress is greatest and most needed, that is, for transplantation. As described in the previous chapter taurine has significant central sympatholytic effects (Paakkari et al., 1982; Kontro and Oja, 1990; Liljequist, 1993; Avanzino et al., 1994; Ye et al., 1997; Saransaari and Oja, 2000; Kakee et al., 2001; Yoshida et al., 2002 Dampney et al., 2003). Thus, we postulate that administering taurine systemically (Milei et al., 1992; Timbrell et al., 1995; Ohno et al., 1999) to the donor 30~60 minutes before

286

W. ORIYANHAN ET AL.

harvesting might prevent the brain-death-induced cardiotoxicity of endogenous catecholamines (Farhat et al., 2001; Yeh et al., 2002). Addition to STS or any preservation solution (Diodato et al., 2004) should maximize taurine’s protective effects. Furthermore, administration of taurine to the recipient before re-establishing flow to the transplanted organ, since it is a most effective anti-oxidant free radical scavenger (Franconi et al., 1985; Wright et al., 1986; Huxtable, 1992; Bkaily et al., 1997; Satoh and Sperelakis, 1998; Schaffer et al., 2002), may further minimize reperfusion injury. 4.1. Limitations and Significance of the Study Because ATP, CP NAD+ were not measured, the inferences are based on indirect but widely accepted evidences of aerobiosis. Studies on blood-perfused models of larger animals might be needed to evaluate the detrimental effects of leukocytes, but because we have only amplified the natural taurine defense mechanisms operational in all animal kingdom organs against ischemia/reperfusion injury, similar results could be anticipated. Even if not all mechanisms are elucidated, a better preservation of the harvested donor hearts might increase the donor pool size and will certainly benefit the recipient.

5. CONCLUSIONS The taurine-perfused isolated rat hearts recovered faster after normothermic 30-min ischemia induced while the hearts were beating. Lactic acid production was decreased and pyruvic acid production increased. The addition of taurine to St. Thomas Hospital cardioplegic solution decreased lactate and efflux of tissue injury markers, maintained CKMB activity and aerobic metabolism, and prevented DNA oxidation, markedly ameliorating LV function in the hearts stored cold for 6 hours 6. REFERENCES Avanzino, G. L., Ruggeri, P., Blanchi, D., Cogo, C. E., Ermirio, R., and Weaver, L. C., 1994, GABAB receptor-mediated mechanisms in the RVLM studied by microinjections of two GABAB receptor antagonists, Am. J. Physiol. 266:H1722. Bkaily, G., Jaalouk, D., Haddad, G., Gros-Louis, N., Simaan, M., Naik, R., and Pothier, P., 1997, Modulation of cytosolic and nuclear Ca2+ and Na+ transport by taurine in heart cells, Mol. Cell. Biochem.170:1. Dampney, R. A., Horiuchi, J., Tagawa, T., Fontes, M. A., Potts, P. D., and Polson, J. W., 2003, Medullary and supramedullary mechanisms regulating sympathetic vasomotor tone, Acta Physiol. Scand. 177:209. Diodato, M. D., Shah, N. R., Prasad, S. M., Gaynor, S. L., Lawton, J. S., and Damiano, R. J. Jr., 2004, Donor heart preservation with pinacidil: the role of the mitochondrial KATP channel, Ann. Thorac. Surg. 78:620. Farhat, F., Loisance, D., Garnier, J. P., and Kirsch, M., 2001, Norepinephrine release after acute brain death abolishes the cardioprotective effects of ischemic preconditioning in rabbit, Eur. J. Cardiothorac. Surg. 19:313. Franconi, F., Stendardi, I., Failli, P., Matucci, R., Baccaro, C., Montorsi, L., Bandinelli, R., and Giotti A., 1985, The protective effects of taurine on hypoxia (performed in the absence of glucose) and on reoxygenation (in the presence of glucose) in guinea-pig heart. Biochem. Pharmacol. 34:2611. Huxtable, R. J., 1992, The physiological actions of taurine, Physiol. Rev. 72:101. Kakee, A., Takanaga, H., Terasaki, T., Naito, M., Tsuruo, T., and Sugiyama, Y., 2001, Efflux of a suppressive neurotransmitter, GABA, across the blood-brain barrier. J. Neurochem. 79:110. Kasai, H. and Nishimura S., 1984, Hydroxylation of deoxyguanosine at the C-8 position by ascorbic acid and other reducing agents, Nucleic Acids Res.12:2137. Kontro, P. and Oja, S. S., 1990, Interactions of taurine with GABAB binding sites in mouse brain, Neuropharmacology 29:243.

REGIONAL TAURINE PERFUSION

287

Li, P. A., Uchino, H., Elmer, E., and Siesjö, B. K., 1997, Amelioration by cyclosporin A of brain damage following 5 or 10 min of ischemia in rats subjected to preischemic hyperglycemia, Brain Res. 753:133. Li, P. A., He, Q. P., Miyash*ta, H., Howllet, W., Siesjö, B. K., and Shuaib, A., 1999a, Hypothermia ameliorates ischemic brain damage and suppresses the release of extracellular amino acids in both normo- and hyperglycemic subjects, Exp. Neurol. 158:242. Li, P. A., Liu, G. J., He, Q, P., Floyd, R. A., and Siesjö, B. K., 1999b, Production of hydroxyl free radical by brain tissues in hyperglycemic rats subjected to transient forebrain ischemia, Free Radic. Biol. Med. 27:1033. Li, P. A., Rasquinha, I., He, Q. P., Siesjö, B. K., Csiszar, K., Boyd, C. D., and MacManus, J. P., 2001 Hyperglycemia enhances DNA fragmentation after transient cerebral ischemia, J. Cereb. Blood Flow Metab. 21:568. Liljequist, R., 1993, Interaction of taurine and related compounds with GABAergic neurones in the nucleus raphe dorsalis, Pharmacol. Biochem. Behav. 44:107. McCord, J. M., 1988, Free radicals and myocardial ischemia: overview and outlook, J. Free Radic. Biol. Med. 4:9. Messina, S. A. and Dawson, R. Jr., 2000, Attenuation of oxidative damage to DNA by taurine and taurine analogs, Adv. Exp. Med. Biol. 483:355. Milei, J., Ferreira, R., Llesuy, S., Forcada, P., Covarrubias, J., and Boveris, A., 1992, Reduction of reperfusion injury with preoperative rapid intravenous infusion of taurine during myocardial revascularization, Am. Heart J.123:339. Miwa, S., Toyokuni, S., Nishina, T., Nomoto, T., Hiroyasu, M., Nishimura, K., and Komeda, M., 2002, Spaciotemporal alteration of 8-hydroxy-2’-deoxyguanosine levels in cardiomyocytes after myocardial infarction in rats, Free Radic. Res. 36:853. Miyamae, M., Camacho, S. A., Weiner, M. W., and Figueredo, V. M., 1996, Attenuation of postischemic reperfusion injury is related to prevention of [Ca2+]i overload in rat hearts, Am. J. Physiol. Heart Circ. 271:2145. Ohno, N., Miyamoto, K. H., and Miyamoto, T. A., 1999, Taurine potentiates the efficacy of hypothermia, Asian Cardiovasc. Thorac. Ann. 7:267. Oriyanhan, W., Yamazaki, K., Miwa, S., Takaba, K., Ikeda, T., and Komeda, M., 2005, Taurine prevents myocardial ischemia/reperfusion induced oxidative stress and apoptosis in the prolonged hypothermic rat heart preservation, Heart Vessels, in press. Paakkari, P., Paakkari, I., Karppanen, H., Halmekoski, J., and Paasonen, M. K., 1982, Cardiovascular and ventilatory effects of taurine and hom*otaurine in anesthetized rats, Med. Biol. 60:316. Saransaari, P. and Oja, S. S., 2000, Taurine release modified by GABAergic agents in hippocampal slices from adult and developing mice, Amino Acids 18:17. Satoh, H. and Sperelakis, N., 1998, Review of some actions of taurine on ion channels of cardiac muscle cells and others, Gen. Pharmacol. 30:451. Schaffer, S. W., Pastukh, V., Solodushko, V., Kramer, J., and Azuma, J., 2002, Effect of ischemia, calcium depletion and repletion, acidosis and hypoxia on cellular taurine content, Amino Acids 23:395. Sharikabad, M. N., Hagelin, E. M., Hagberg, I. A., Lyberg, T., and Brors, O., 2000, Effect of calcium on reactive oxygen species in isolated rat cardiomyocytes during hypoxia and reoxygenation, J. Mol. Cell Cardiol. 32:441. Siesjö, B. K., Katsura, K. I., Kristian, T., Li, P. A., Siesjö, P., 1996, Molecular mechanisms of acidosis-mediated damage, Acta Neurochir. Suppl. 66:8. Takahashi, K., Ohyabu, Y., Takahashi, K., Solodushko, V., Takatani, T., Itoh, T., Schaffer, S. W., and Azuma, J., 2003, Taurine renders the cell resistant to ischemia-induced injury in cultured neonatal rat cardiomyocytes, J. Cardiovasc. Pharmacol. 41:726. Takatani, T, Takahashi, K, Uozumi, Y, Matsuda, T, Ito, T, Schaffer, SW, Fujio, Y, and Azuma, J., 2004, Taurine prevents the ischemia-induced apoptosis in cultured neonatal rat cardiomyocytes through Akt/caspase-9 pathway, Biochem. Biophys. Res. Commun. 316:484. Thatte, H. S., Rhee, J,-H., Zagarins, S. E., Treanor, P. R., Birjiniuk, V., Crittenden, M. D., and Khuri, S. F., 2004, Acidosis-induced apoptosis in human and porcine heart, Ann. Thorac. Surg. 77:1376. Timbrell, J. A., Seabra, V., and Waterfield, C. J., 1995, The in vivo and in vitro protective properties of taurine, Gen. Pharmacol. 26:453. Toyokuni, S., Tanaka, T., Hattori, Y., Nishiyama, Y., Yoshida, A., Uchida, I., Hirai, H., Ochi, H., and Osawa, T., 1997, Quantitative immunohistochemical determination of 8-hydroxy-2 -deoxyguanosine by a monoclonal antibody N45.1: its application to ferric nitrilotriacetate-induced renal carcinogenesis model, Lab. Invest. 76:365. Toyokuni, S., 1999, Reactive oxygen species-induced molecular damage and its application in pathology, Pathol. Int. 49:91.

288

W. ORIYANHAN ET AL.

Wettstein, M. and Haussinger, D., 2000, Taurine attenuates cold ischemia-reoxygenation injury in rat liver. Transplantation 69:2290. Wingenfeld, P., Gehrmann, U., Strubind, S., Minor, T., Isselhard, W., and Michalk, D. V., 1996, Long-lasting hypoxic preservation of porcine kidney cells. Beneficial effect of taurine on viability and metabolism in a simplified transplantation model, Adv. Exp. Med. Biol. 403:203. Wright, C. E., Tallan, H. H., and Lin, Y. Y., 1986, Taurine: biological update, Annu. Rev. Biochem. 55:427. Yamazaki, K., Miwa, S., Ueda, K., Tanaka, S., Toyokuni, S., Oriyanhan, W., Nishimura, K., and Komeda, M., 2004, Prevention of myocardial reperfusion injury by poly (ADP-ribose) synthetase inhibitor, 3-aminobenzamide, in cardioplegic solution: in vitro study of isolated rat heart model, Eur. J. Cardiothorac. Surg. 26:270. Ye, G., Tse, A. C., and Yung, W., 1997, Taurine inhibits rat substantia nigra pars reticulata neurons by activation of GABA- and glycine-linked chloride conductance, Brain Res. 749:175. Yeh, T. Jr, Wechsler, A. S., Graham, L., Loesser, K. E., Sica, D. A., Wolfe, L., and Jakoi, E. R., 2002, Central sympathetic blockade ameliorates brain death-induced cardiotoxicity and associated changes in myocardial gene expression, J. Thorac. Cardiovasc. Surg. 124:1087. Yoshida, S., Matsubara, T., Uemura, A., Iguchi, A., and Hotta, N., 2002, Role of medial amygdala in controlling hemodynamics via GABAA receptor in anesthetized rats, Circ. J. 66:197.

THE EFFECT OF DIETARY TAURINE SUPPLEMENTATION ON PLASMA AND LIVER LIPID CONCENTRATIONS AND FREE AMINO ACID CONCENTRATIONS IN RATS FED A HIGH-CHOLESTEROL DIET Mi-Ja Choi, Jung-Hee Kim, and Kyung Ja Chang*

1. ABSTRACT The purpose of this study was to investigate the effect of dietary taurine supplementation on plasma and liver lipid concentrations, and free amino acid concentrations in rats fed a high-cholesterol diet. Twenty male rats (body weight 151 ± 1.9 g) were randomly divided into two groups. The rats in the control group were fed on 1.5% cholesterol diet (control) and those in the experimental group were fed with 1.5% cholesterol and 1.5% taurine diet (TSD). All rats were fed with the experimental diets and deionized water ad libitum for 5 weeks. The plasma glucose and lipid concentrations were measured using commercial kits with enzymatic methods and liver lipid concentrations with the Folch method. The concentrations of free amino acids in plasma were determined with an automated amino acid analyzer based on ion-exchange chromatography. There were no significant differences in the body weight gain, food intake and food efficiency ratio between the control and experimental groups. The rats fed TSD had significantly lower liver weight and liver weight/body weight ratio than those fed control diet. The plasma concentrations of total cholesterol, glucose and LDLcholesterol were significantly reduced in the rats fed TSD compared to those fed control diet. The rats fed TSD showed significantly decreased liver levels of cholesterol and triglyceride. The HDL-cholesterol level was higher in the rats fed TSD than those fed control diet. The plasma taurine concentrations were not significantly different between two groups. They exhibited significant negative correlation with the plasma total cholesterol and liver triglyceride concentrations. These results suggest the possible role of taurine as a hypocholesterolemic agent in the rats fed a high cholesterol diet. Taurine Mi-Ja Choi, Jung-Hee Kim, Department of Food and Nutrition, Keimyung University, Kyung Ja Chang, Department of Food and Nutrition, Inha University, Korea. Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

235

236

M. J. CHOI ET AL.

supplementation did not cause any characteristic changes in the plasma aminogram pattern, body weight gain, and food intake.

2. INTRODUCTION Numerous studies have been done on the effect of taurine on cholesterol metabolism (Petty et al., 1990, Yan et al., 1993, Murakami et al., 2002, Kishida et al., 2003) in various species, including rats, guinea pigs, rabbits, and cats. Almost all of the experiments have been done on animals with hypercholesterolemia induced by feeding a high-cholesterol diet. Recently, Nanami et al. (1996) also reported a hypocholesterolemic action of taurine in rats fed a high-cholesterol diet, but the mechanism of its action is unclear. Furthermore, Park et al. (1998) reported a hypocholesterolemic action of taurine in rats fed a high-cholesterol diet. However, addition of taurine to the diet did not reduce the serum level of cholesterol in rats (Mochizuki et al., 1998). Therefore, more studies are needed to figure out the beneficial effects of taurine on cholesterol metabolism. Moreover, none of the above-mentioned studies was performed predominantly in view of the plasma taurine concentration. With the increasing use of amino acids as dietary supplements, it is of importance to recognize those amino acids, which may prove to be potentially toxic and the conditions under which such toxicities would most likely be encountered. Taurine is thought to be quite safe and there is little concern about the side effects of excessive intake of taurine (Furukawa et al., 1991). In particular, little is known about the relationship between changes in plasma taurine and other amino acid levels. There are a number of repots indicating modifications of taurine concentrations in plasma in specific conditions. Due to the lack of information concerning taurine, the aim of the present work was to determine the concentration of taurine and other amino acids in plasma in hyperlipidemic rats after supplementation with taurine. Therefore, we studied the possible relation between the plasma taurine concentration and plasma lipids.

3. MATERIALS AND METHODS Male Sprague-Dawley rats weighing about 150 g (Seoul) were fed an AIN-76 standard rat diet. The rats were randomly assigned to 2 groups of 10 rats in each: those with a taurine-supplemented diet (taurine-supplemented group, TSD) and those without supplementation (unsupplemented group, control). The compositions of the experimental diets are shown in Table 1. All animals were fed the high-cholesterol diet. The rats were individually housed in stainless steel cages in a room with controlled temperature (23°C) and humidity (55%) and were given free access to the experimental diets and water. The rats were maintained in a 12-h light (07:00–19:00 h) and dark cycle. Plasma was separated from blood by centrifugation (1600 x g, 15 min, 4oC). Plasma lipids (total cholesterol, HDL-cholesterol and triglycerides) were determined by using commercial kits (Wako Pure Chemical, Osaka). The LDL-cholesterol concentrations were estimated with the equation of Friedewald et al. (1972). About 2 g of liver were hom*ogenized, and lipids extracted with chloroform: methanol mixture (2:1 v/v), as described by Folch et al. (1957). The concentration of liver cholesterol in the lipid extracts was measured enzymatically by using a kit (Wako Pure Chemical, Osaka).

EFFECTS OF TAURINE ON PLASMA LIPIDS AND AMINO ACID CONCENTRATIONS

237

Table 1. Composition of experimental diets (g/100 g diet) Ingredient Casein (3) Corn starch (4) Corn oil (5) Cellulose (6) Mineral mixture (7) Vitamin mixture (8) Cholesterol (9) Taurine (10)

Dietary group Control (1) TSD (2) 18 18 63.5 62.0 10 10 2 2 4 4 1 1 1.5 1.5 1.5

(1) Control: high cholesterol control diet. (2) TSD: high-cholesterol taurine-supplemented diet. (3) Casein, Maeil dairy industry Co., Ltd. 480 Gagok-Ri, Jinwi-Myun, Pyungtaek-City, Kyunggi-Do. (4) Corn starch, Doosan Co. 234-17 Maam-Ri, Bubal-Eup, Ichon-City, Kyunggi-Do. (5) Corn-oil, Shindong-bang oil Co. 4-2 Yangpyung-Dong, Youngdongpo-Gu Seoul: KSH 2102. (6) Cellulose, supplied by Sigma Chemical company No. C8002. (7) Mineral mixture, supplied by US Corning Laboratory Services Company, Teklad test diets, Madison, Wisconsin, Biological Test Material No.170915. (8) Vitamin mixture, supplied by US Corning Laboratory Services Company, Teklad Test Diets, Madison, Wisconsin, Biological Test Material No.40077. (9) Cholesterol, supplied by Sigma Chemical Company No. 2044. (10) Taurine, Dong-A Pharm. Co. Ltd. 434-4 Moknae-dong, Ansan-City, Kyunggi-Do.

Plasma was deproteinized by using sulfosalicylic acid, and taurine concentrations in plasma were measured with an automatic amino acid analyzer based on ion-exchange chromatography (Biochrom 20, Pharmacia Biotech, Cambridge). The SAS statistical package (version 8.12; SAS Institute Inc, Cary, NC) was used for the analysis. To assess the mean difference for continuous variables between the control and experimental groups, Student's t-test for independent group was used. Pearson correlation coefficients were calculated to describe associations between the taurine concentrations and blood lipids. The results are expressed as means ± SD. Values were reported as significant when P values < 0.05.

4. RESULTS AND DISCUSSION 4.1. Weight Gain and FER Table 2 shows the weight at beginning, weight at sacrifice, weight gain, food intake and food efficiency ratio (FER) of rats fed with the experimental diets. The body weight gain and food intake of rats fed the experimental diet (taurine 15 g/kg diet) did not differ from those of rats fed the control diet. This finding is in agreement with Sugiyama and co-workers (1989) who reported that taurine supplementation had no influence on the weight gain and food intake of the animals. 4.2. Liver Weight The weight of liver was significantly lower in the rats fed taurine-supplemented diet than in the rats fed control diet (10.93 ± 0.95 g vs. 15.20 ± 0.86 g) (Table 3). This finding is in agreement with other studies. Yokogoshi and co-workers (1999) reported that taurine

M. J. CHOI ET AL.

238

supplementation significantly decreased (37%) the liver weight when the rats fed a highcholesterol diet. Table 2. Weight, food intake and FER of rats fed control and TSD diets during experimental period Variables Control TSD Significance Weight at beginning (g) Weight at sacrifice (g) Weight gain (g) Food intake (g/day) FER (3)

150.1 ± 1.7 (1) 329.5 ± 13.1 179.9 ± 8.6 21.91 ± 0.55

150.4 ± 1.9 323.9 ± 12.9 172.4 ± 7.6 21.97 ± 1.29

0.26 ± 0.07

0.23 ± 0.01

NS (2) NS NS NS NS

(1) Values are means ± SD. (2) NS: Not significantly different at p 20-min CKMB levels most likely indicate a progressive decrease of the leaky membrane at this early time. The higher 5-min CKMB represents the higher ability to support aerobic metabolism, that is, viability but not irreversible injury in this model. Furthermore, the greater correlation of 5-min CKMB with some parameters (GPT, GOT, LDH, CPK, LA, PA, LA/PA and HW) than that of 8-OHdG is

W. ORIYANHAN ET AL.

284

150 125 100

No-Tau No-Tau r2=0.6452 p< 0.0001 No-Tau

75 (all)

TAURINE (all) r2=0.3644 p< 0.0001

25 0 0.050

0.075

0.100

0.125

5' CKMB (IU/gHW/min)

3000 2500 2000

20'(all) r 2=0.5746 p=< 0.0001

20'(all including CONTROL)

20' no-tau

20' TAU CONTROL

1500 1000 500

20' no-tau 0 0.000

0.025

0.050

20' no-tau r 2=0.7184 p=0.0079

0.075

0.100

0.125

20'or CONTROL CKMB (IU/gHW/min)

REGIONAL TAURINE PERFUSION

285

286

W. ORIYANHAN ET AL.

REGIONAL TAURINE PERFUSION

287

288

W. ORIYANHAN ET AL.

Part 4. Taurine in Heart and Muscles

MOLECULAR MECHANISMS OF CARDIOPROTECTION BY TAURINE ON ISCHEMIA-INDUCED APOPTOSIS IN CULTURED CARDIOMYOCYTES

Kyoko Takahashi, Tomoka Takatani, Yoriko Uozumi, Takashi Ito, Takahisa Matsuda, Yasushi Fujio, Stephen W. Schaffer, and Junichi Azuma

1. INTRODUCTION An integral part of the pathogenesis of heart failure is myocyte loss. The traditional explanation for myocyte loss was cell necrosis but there has been a surge of evidence affirming the role of apoptosis in the genesis of heart failure (Garg et al., 2005). Evidence for apoptotic cell death was shown in clinical cases of myocardial infarction, as well as in rabbit, rat, and mouse models of continuous ischemia or ischemia/reperfusion (Garg et al., 2005). It has been shown that the mitochondrial pathways participate in apoptosis induced by ischemia (Garg et al., 2005). Taurine (2-aminoethanesulfonic acid), the E-amino acid, is one of the factors that regulates the degree of apoptosis during ischemia (Roysommuti et al., 2003; Schaffer et al., 2003). However, little is known about the cytoprotective signalling pathways mediate this response. We have previously reported that isolated neonatal cardiomyocytes become resistant to ischemia-induced apoptosis when exposed to medium containing 20 mM taurine (Takahashi et al., 2003). In this study, the interaction between taurine and mitochondria-mediated apoptosis is investigated in a newly developed simulated ischemia model utilizing isolated cardiomyocytes that are incubated with medium containing and lacking taurine and then sealed within cultured flasks (Takahashi et al., 2003, Takatani et al., 2004a,b).

Kyoko Takahashi, Tomoka Takatani, Yoriko Uozumi, Takashi Ito, Takahisa Matsuda, Yasushi Fujio, and Junichi Azuma, Graduate School of Pharmaceutical Sciences, Osaka University, Osaka, Japan, Stephen W. Schaffer, University of South Alabama, School of Medicine, Mobile, AL, USA.

Taurine 6 Edited by S. S. Oja and P. Saransaari, Springer, New York 2006

257

258

K. TAKAHASHI ET AL.

2. MATERIALS AND METHODS 2.1 Cell Cultures and the Newly Simulated Ischemia Model Primary cardiomyocyte cultures from 1-day–old Wistar rats were prepared according to the procedure described previously (Takahashi et al., 2001). All experimental procedures were approved by the Animal Care Committee of Osaka University and conformed to international guidelines. The simulated ischemia model mimics the clinical stresses of ischemia, including the stresses of hypoxia, acidosis, and stagnant incubation medium (Takahashi et al., 2001). 2.2. Detection of Mitochondrial Dysfunction and Ischemia-Induced Apoptosis of Cardiomyocytes Evaluation of apoptosis was performed with a fluorescent dye, Hoechst 33258, and a commercially available cell death detection kit to find DNA strand breaks using the terminal deoxynucleotidyl transferase-mediated dUDP nick-end labelling (TUNEL) reagent. Loss of mitochondrial membrane potential (ǻȥ) was assessed using a fluorescent dye, the lipophilic cationic probe JC-1(5,5’,6,6’-tetrachloro-1,1’,3,3’- tetraethylbenzimidazolylcarbonyanine). Cells were incubated with JC-1 and examined with an Olympus fluorescence microscope. 2.3. Western Blot Analysis Proteins from the mitochondrial fraction, cytosolic fraction and the total cell lysates were analyzed by SDS-PAGE (12.5% or 14% gel). After blotting, the Immobilon-P membrane (Millipore) was blocked with 5% bovine serum albumin (BSA) in Tween 20-containing phosphate-buffered saline (PBS) at room temperature for 1 hour. Immunoblots were incubated at room temperature for 60 minutes with the specific primary antibody to anti-cytochrome c antibody, anti-Bax, anti-Bcl-2, anti-p53, Apaf-1, caspase-3, -9, Akt, phosphorylated Akt or hemagglutinin (HA). After further washing, the membrane was incubated for 60 minutes with the secondary antibody (horseradish peroxidase-conjugated). The ECL reaction was used for detection. Blots were reprobed with anti-actin antibody as a loading control. Quantitative analysis of immunoblotted bands was performed by computer program (NIH Image, Version 1.61). 2.4 Adenovirus The recombinant replication-defective adenovirus expressing a dominant-negative form of Akt (dnAkt) was prepared as described Fujio et al. (2000). 2.5. Statistical Analysis Statistical evaluation of data was performed either with Student’s t test, Ȥ2-test or analysis of variance with the Bonferroni method used to compare individual data points for a significant F value. Each value was expressed as mean ± SEM. Differences were considered significant when the calculated p value was 3>2>1.5 mmol/kg) increase in GABA within 30 minutes of administration (Table 1). It was followed by intermediate effects consisting of significant and rapid dose-related decrease in GABA (2.5>1.5>2.0>3.0 mmol/kg) in the next 30 minutes, reaching the nadir at time 3=3.75 hours post-dosing to a slightly lower actual GABA concentration but still a higher percentage change from the baseline than in the placebo group (Fig. 5A,B). These relationships are maintained almost without change (plateau) to the end of the experiment. 3.1.2. Taurine Effects on Circulating Insulin Early dose-related decreases in insulin are of smaller magnitude than those in IGF-1 but still significant within 30 minutes of dosing (Table 1), followed by an intermediate significant dose-related (3.0>2.0>1.5 mmol/kg) increase of % baseline at 3.75 hours post-dosing, and the late gradual return towards the baseline levels (Fig. 6A,B). 3.1.2a. GABA Changes Precede Insulin Changes. The early significant increase in GABA above the baseline levels precede the early decrease in insulin, which is followed by a dose-dependent decrease during the intermediate phase of 1 to 1.5 hours post-dosing before the dose-dependent insulin increase. The insulin increase reaches a maximum 3.75 hours post-dosing, coinciding with the lowest level of GABA (Fig. 6C).

Table 1. Early (30 minute) effects of 3 doses of taurine on plasma GABA, insulin, and IGF-1 Taurine dose (mmol/kg)

30 minute interval

GABA (pmol/ml)

Insulin (ng/ml)

IGF-1 (ng/ml)

Baseline paired “t” P Post-LAP

199.5 ± 30.31 0.189 207.1 ± 32.37

0.291 ± 0.114 0.64 0.273 ± 0.155

Baseline paired “t” P Post-LAP

198.1 ± 33.75 P

Taurine 6 (Advances in Experimental Medicine and Biology Vol 583) - PDF Free Download (2024)